Incidental Mutation 'R8288:Trim40'
ID 638547
Institutional Source Beutler Lab
Gene Symbol Trim40
Ensembl Gene ENSMUSG00000073399
Gene Name tripartite motif-containing 40
Synonyms LOC195359, LOC240093, LOC333872
MMRRC Submission 067710-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.057) question?
Stock # R8288 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 36881598-36890123 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 36883318 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 161 (D161G)
Ref Sequence ENSEMBL: ENSMUSP00000084400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087158] [ENSMUST00000172711]
AlphaFold Q3UWA4
Predicted Effect probably benign
Transcript: ENSMUST00000087158
AA Change: D161G

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000084400
Gene: ENSMUSG00000073399
AA Change: D161G

DomainStartEndE-ValueType
RING 12 54 6e-8 SMART
Pfam:zf-B_box 65 105 1.1e-6 PFAM
coiled coil region 106 150 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172711
AA Change: D161G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000133581
Gene: ENSMUSG00000073399
AA Change: D161G

DomainStartEndE-ValueType
RING 12 54 6e-8 SMART
Pfam:zf-B_box 65 105 3.4e-7 PFAM
coiled coil region 106 150 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tripartite motif (TRIM) protein family. The encoded protein may play a role as a negative regulator against inflammation and carcinogenesis in the gastrointestinal tract. Alternatively spliced transcript variants that encode different protein isoforms have been described. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3m2 C T 8: 22,793,137 A200T probably benign Het
Arpp19 T C 9: 75,037,632 M1T probably null Het
Baiap2 T A 11: 119,997,639 V407E probably damaging Het
Cdh18 A G 15: 23,445,987 T508A probably damaging Het
Cnnm3 C A 1: 36,511,993 A28E possibly damaging Het
Cpb1 A T 3: 20,265,367 C184* probably null Het
Ddb1 T C 19: 10,608,348 V142A probably benign Het
Disp2 T C 2: 118,790,281 V498A probably damaging Het
Dmgdh T C 13: 93,708,824 Y442H probably damaging Het
Eef2k T A 7: 120,903,381 M722K probably damaging Het
Erbb4 A G 1: 68,298,350 F603S probably damaging Het
Filip1l C T 16: 57,570,554 R502C probably damaging Het
Gbp9 C T 5: 105,105,733 V39M probably damaging Het
Gm17079 T C 14: 51,694,358 Y98C Het
Gstz1 A G 12: 87,147,830 M1V probably null Het
Hsd17b13 T G 5: 103,963,835 I281L probably benign Het
Hydin A G 8: 110,507,029 E1833G probably damaging Het
Irs1 G A 1: 82,287,961 Q845* probably null Het
Kctd11 C T 11: 69,880,057 G52R probably damaging Het
Kit T C 5: 75,654,489 S962P probably damaging Het
Lrrn1 C T 6: 107,566,994 probably benign Het
Mastl T C 2: 23,133,359 K451E probably damaging Het
Mptx2 A G 1: 173,274,789 V111A probably benign Het
Nuak2 G T 1: 132,327,841 C178F probably damaging Het
Pah G A 10: 87,538,185 R71H probably benign Het
Pclo C A 5: 14,712,871 T501K Het
Pla2g4e C T 2: 120,188,509 probably null Het
Polq A G 16: 37,027,910 E293G probably damaging Het
Rptor G A 11: 119,857,937 E782K probably benign Het
Scn7a T A 2: 66,675,974 R1524W probably damaging Het
Slc4a5 T C 6: 83,226,255 S46P probably benign Het
Srcap T A 7: 127,531,356 I664N probably damaging Het
Stk24 A C 14: 121,293,429 F372V possibly damaging Het
Szt2 T C 4: 118,389,776 S881G probably damaging Het
Trip11 T C 12: 101,894,384 H234R possibly damaging Het
Trpc1 T C 9: 95,721,381 K366R probably damaging Het
Ugt2b35 T C 5: 87,001,457 L189P probably damaging Het
Unc80 A G 1: 66,473,350 S140G probably benign Het
Wdr60 A G 12: 116,213,725 F811S probably damaging Het
Zfp446 A G 7: 12,977,958 E36G probably benign Het
Zfp738 T A 13: 67,670,789 H361L possibly damaging Het
Other mutations in Trim40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Trim40 APN 17 36882397 makesense probably null
IGL01085:Trim40 APN 17 36883241 missense probably benign 0.01
IGL02071:Trim40 APN 17 36889178 missense probably benign
IGL02343:Trim40 APN 17 36889138 missense probably benign 0.03
R0116:Trim40 UTSW 17 36883147 critical splice donor site probably null
R1853:Trim40 UTSW 17 36889078 missense probably damaging 1.00
R2216:Trim40 UTSW 17 36888983 missense probably benign 0.10
R4649:Trim40 UTSW 17 36882639 splice site probably null
R4903:Trim40 UTSW 17 36883225 missense possibly damaging 0.95
R5384:Trim40 UTSW 17 36888865 missense probably damaging 0.99
R5680:Trim40 UTSW 17 36888982 missense probably damaging 0.99
R5969:Trim40 UTSW 17 36882427 missense probably benign
R6830:Trim40 UTSW 17 36888850 missense possibly damaging 0.89
R7008:Trim40 UTSW 17 36883976 missense probably damaging 1.00
R7112:Trim40 UTSW 17 36882642 missense probably null 1.00
R7283:Trim40 UTSW 17 36882662 missense probably benign 0.05
R9742:Trim40 UTSW 17 36889010 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- GAATCCCTCTCTGAACTTGGGG -3'
(R):5'- CCTGAAGTACAATGGCTGGTG -3'

Sequencing Primer
(F):5'- GGTGTCTTAGGAAGTACACCTTC -3'
(R):5'- CTGGTGAGGCAAGGCTG -3'
Posted On 2020-07-28