Incidental Mutation 'R8288:Ddb1'
ID 638548
Institutional Source Beutler Lab
Gene Symbol Ddb1
Ensembl Gene ENSMUSG00000024740
Gene Name damage specific DNA binding protein 1
Synonyms DNA repair protein, p127-Ddb1, damage-specific DNA-binding protein, DNA repair
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8288 (G1)
Quality Score 225.009
Status Not validated
Chromosome 19
Chromosomal Location 10605625-10629813 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 10608348 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 142 (V142A)
Ref Sequence ENSEMBL: ENSMUSP00000025649 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025649] [ENSMUST00000037678]
AlphaFold Q3U1J4
Predicted Effect probably benign
Transcript: ENSMUST00000025649
AA Change: V142A

PolyPhen 2 Score 0.118 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000025649
Gene: ENSMUSG00000024740
AA Change: V142A

DomainStartEndE-ValueType
Pfam:MMS1_N 75 543 1.9e-122 PFAM
low complexity region 755 775 N/A INTRINSIC
Pfam:CPSF_A 788 1099 1e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000037678
SMART Domains Protein: ENSMUSP00000044556
Gene: ENSMUSG00000034371

DomainStartEndE-ValueType
Pfam:Dak1 19 335 1.9e-112 PFAM
low complexity region 352 366 N/A INTRINSIC
Dak2 398 571 1.47e-58 SMART
Meta Mutation Damage Score 0.4445 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the large subunit (p127) of the heterodimeric DNA damage-binding (DDB) complex while another protein (p48) forms the small subunit. This protein complex functions in nucleotide-excision repair and binds to DNA following UV damage. Defective activity of this complex causes the repair defect in patients with xeroderma pigmentosum complementation group E (XPE) - an autosomal recessive disorder characterized by photosensitivity and early onset of carcinomas. However, it remains for mutation analysis to demonstrate whether the defect in XPE patients is in this gene or the gene encoding the small subunit. In addition, Best vitelliform mascular dystrophy is mapped to the same region as this gene on 11q, but no sequence alternations of this gene are demonstrated in Best disease patients. The protein encoded by this gene also functions as an adaptor molecule for the cullin 4 (CUL4) ubiquitin E3 ligase complex by facilitating the binding of substrates to this complex and the ubiquitination of proteins. [provided by RefSeq, May 2012]
PHENOTYPE: Complete deletion of this gene results in embryonic lethality; conditional mutation causes increased apoptosis in the developing brain, and defects in lens formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3m2 C T 8: 22,793,137 A200T probably benign Het
Arpp19 T C 9: 75,037,632 M1T probably null Het
Baiap2 T A 11: 119,997,639 V407E probably damaging Het
Cdh18 A G 15: 23,445,987 T508A probably damaging Het
Cnnm3 C A 1: 36,511,993 A28E possibly damaging Het
Cpb1 A T 3: 20,265,367 C184* probably null Het
Disp2 T C 2: 118,790,281 V498A probably damaging Het
Dmgdh T C 13: 93,708,824 Y442H probably damaging Het
Eef2k T A 7: 120,903,381 M722K probably damaging Het
Erbb4 A G 1: 68,298,350 F603S probably damaging Het
Filip1l C T 16: 57,570,554 R502C probably damaging Het
Gbp9 C T 5: 105,105,733 V39M probably damaging Het
Gm17079 T C 14: 51,694,358 Y98C Het
Gstz1 A G 12: 87,147,830 M1V probably null Het
Hsd17b13 T G 5: 103,963,835 I281L probably benign Het
Hydin A G 8: 110,507,029 E1833G probably damaging Het
Irs1 G A 1: 82,287,961 Q845* probably null Het
Kctd11 C T 11: 69,880,057 G52R probably damaging Het
Kit T C 5: 75,654,489 S962P probably damaging Het
Lrrn1 C T 6: 107,566,994 probably benign Het
Mastl T C 2: 23,133,359 K451E probably damaging Het
Mptx2 A G 1: 173,274,789 V111A probably benign Het
Nuak2 G T 1: 132,327,841 C178F probably damaging Het
Pah G A 10: 87,538,185 R71H probably benign Het
Pclo C A 5: 14,712,871 T501K Het
Pla2g4e C T 2: 120,188,509 probably null Het
Polq A G 16: 37,027,910 E293G probably damaging Het
Rptor G A 11: 119,857,937 E782K probably benign Het
Scn7a T A 2: 66,675,974 R1524W probably damaging Het
Slc4a5 T C 6: 83,226,255 S46P probably benign Het
Srcap T A 7: 127,531,356 I664N probably damaging Het
Stk24 A C 14: 121,293,429 F372V possibly damaging Het
Szt2 T C 4: 118,389,776 S881G probably damaging Het
Trim40 T C 17: 36,883,318 D161G probably benign Het
Trip11 T C 12: 101,894,384 H234R possibly damaging Het
Trpc1 T C 9: 95,721,381 K366R probably damaging Het
Ugt2b35 T C 5: 87,001,457 L189P probably damaging Het
Unc80 A G 1: 66,473,350 S140G probably benign Het
Wdr60 A G 12: 116,213,725 F811S probably damaging Het
Zfp446 A G 7: 12,977,958 E36G probably benign Het
Zfp738 T A 13: 67,670,789 H361L possibly damaging Het
Other mutations in Ddb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Ddb1 APN 19 10611664 missense possibly damaging 0.85
IGL00742:Ddb1 APN 19 10610760 missense probably benign
IGL01161:Ddb1 APN 19 10605707 start codon destroyed probably null 1.00
IGL01364:Ddb1 APN 19 10627660 critical splice donor site probably null
IGL01804:Ddb1 APN 19 10613018 missense probably damaging 1.00
IGL01812:Ddb1 APN 19 10613018 missense probably damaging 1.00
IGL02523:Ddb1 APN 19 10627632 missense probably damaging 1.00
IGL02609:Ddb1 APN 19 10622466 missense possibly damaging 0.93
IGL02664:Ddb1 APN 19 10607883 missense probably benign
IGL03033:Ddb1 APN 19 10625926 missense possibly damaging 0.59
IGL03092:Ddb1 APN 19 10612945 missense probably damaging 1.00
IGL03110:Ddb1 APN 19 10612945 missense probably damaging 1.00
IGL03256:Ddb1 APN 19 10621861 missense probably benign 0.01
Dubitable UTSW 19 10622499 critical splice donor site probably null
Indubitable UTSW 19 10607911 critical splice donor site probably null
Van_der_waals UTSW 19 10612916 missense probably benign 0.11
PIT4445001:Ddb1 UTSW 19 10625970 missense probably damaging 1.00
R0028:Ddb1 UTSW 19 10619246 missense probably damaging 1.00
R0589:Ddb1 UTSW 19 10621716 missense probably benign 0.02
R0893:Ddb1 UTSW 19 10612916 missense probably benign 0.11
R1374:Ddb1 UTSW 19 10608318 missense probably damaging 1.00
R1611:Ddb1 UTSW 19 10612888 missense probably damaging 1.00
R1611:Ddb1 UTSW 19 10626764 critical splice donor site probably null
R1661:Ddb1 UTSW 19 10629080 missense probably benign 0.00
R1835:Ddb1 UTSW 19 10626593 missense probably damaging 1.00
R2036:Ddb1 UTSW 19 10610822 splice site probably benign
R2094:Ddb1 UTSW 19 10612936 missense probably benign
R2142:Ddb1 UTSW 19 10619126 critical splice donor site probably null
R2213:Ddb1 UTSW 19 10608327 missense probably damaging 1.00
R2318:Ddb1 UTSW 19 10626628 missense probably damaging 1.00
R2354:Ddb1 UTSW 19 10606973 missense probably benign 0.03
R3150:Ddb1 UTSW 19 10612982 missense probably benign 0.02
R3162:Ddb1 UTSW 19 10625971 missense probably damaging 0.99
R3162:Ddb1 UTSW 19 10625971 missense probably damaging 0.99
R3606:Ddb1 UTSW 19 10628493 missense probably damaging 1.00
R4050:Ddb1 UTSW 19 10627807 missense probably benign 0.00
R5157:Ddb1 UTSW 19 10622364 missense probably benign 0.01
R6244:Ddb1 UTSW 19 10625923 missense probably damaging 0.99
R6249:Ddb1 UTSW 19 10605720 nonsense probably null
R6812:Ddb1 UTSW 19 10622499 critical splice donor site probably null
R7337:Ddb1 UTSW 19 10627831 missense possibly damaging 0.88
R7460:Ddb1 UTSW 19 10607911 critical splice donor site probably null
R7737:Ddb1 UTSW 19 10625974 missense possibly damaging 0.93
R7903:Ddb1 UTSW 19 10608348 missense probably benign 0.12
R8376:Ddb1 UTSW 19 10619305 missense probably damaging 1.00
R8970:Ddb1 UTSW 19 10608444 missense probably benign 0.01
R9720:Ddb1 UTSW 19 10608360 missense probably benign
RF016:Ddb1 UTSW 19 10627858 missense probably damaging 1.00
X0050:Ddb1 UTSW 19 10626659 missense possibly damaging 0.95
Z1088:Ddb1 UTSW 19 10619230 missense probably damaging 0.99
Z1177:Ddb1 UTSW 19 10608396 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTGGGAAAGCTTTGTACC -3'
(R):5'- AGTCAACACTTCTCCTAGCCTG -3'

Sequencing Primer
(F):5'- CTGGGAAAGCTTTGTACCCAGTATC -3'
(R):5'- ACACATTCCTTTGGCAAGCATC -3'
Posted On 2020-07-28