Incidental Mutation 'R8289:Ssh1'
ID638564
Institutional Source Beutler Lab
Gene Symbol Ssh1
Ensembl Gene ENSMUSG00000042121
Gene Nameslingshot protein phosphatase 1
SynonymsmSSH-1L, LOC384311
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8289 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location113937094-113993894 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113942384 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 995 (D995G)
Ref Sequence ENSEMBL: ENSMUSP00000124312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077689] [ENSMUST00000112298] [ENSMUST00000159592]
Predicted Effect probably benign
Transcript: ENSMUST00000077689
AA Change: D952G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000076873
Gene: ENSMUSG00000042121
AA Change: D952G

DomainStartEndE-ValueType
Pfam:DEK_C 208 261 1.1e-19 PFAM
DSPc 265 403 7.82e-47 SMART
low complexity region 490 503 N/A INTRINSIC
low complexity region 654 669 N/A INTRINSIC
low complexity region 686 704 N/A INTRINSIC
low complexity region 732 748 N/A INTRINSIC
low complexity region 874 892 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112298
AA Change: D973G

PolyPhen 2 Score 0.113 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000107917
Gene: ENSMUSG00000042121
AA Change: D973G

DomainStartEndE-ValueType
low complexity region 13 22 N/A INTRINSIC
Pfam:DEK_C 229 282 9.5e-20 PFAM
DSPc 286 424 7.82e-47 SMART
low complexity region 511 524 N/A INTRINSIC
low complexity region 675 690 N/A INTRINSIC
low complexity region 707 725 N/A INTRINSIC
low complexity region 753 769 N/A INTRINSIC
low complexity region 895 913 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159592
AA Change: D995G

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000124312
Gene: ENSMUSG00000042121
AA Change: D995G

DomainStartEndE-ValueType
low complexity region 13 22 N/A INTRINSIC
Pfam:DEK_C 252 303 2.3e-17 PFAM
DSPc 308 446 7.82e-47 SMART
low complexity region 533 546 N/A INTRINSIC
low complexity region 697 712 N/A INTRINSIC
low complexity region 729 747 N/A INTRINSIC
low complexity region 775 791 N/A INTRINSIC
low complexity region 917 935 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the slingshot homolog (SSH) family of phosphatases, which regulate actin filament dynamics. The SSH proteins dephosphorylate and activate the actin binding/depolymerizing factor cofilin, which subsequently binds to actin filaments and stimulates their disassembly. Cofilin is inactivated by kinases such as LIM domain kinase-1 (LIMK1), which may also be dephosphorylated and inactivated by SSH proteins. The SSH family thus appears to play a role in actin dynamics by reactivating cofilin proteins. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 C A 5: 89,775,423 D175Y possibly damaging Het
Adra1b G A 11: 43,835,488 P201S probably damaging Het
Ahnak2 A G 12: 112,775,808 V610A possibly damaging Het
Ap5s1 A C 2: 131,212,459 H62P probably benign Het
Apeh A G 9: 108,086,245 S593P probably damaging Het
Arhgap24 T C 5: 102,880,826 V289A possibly damaging Het
Atoh1 A G 6: 64,729,909 E196G probably damaging Het
Atp1b3 G A 9: 96,333,549 S271L probably benign Het
Atp6v0a1 A G 11: 101,034,105 R339G probably damaging Het
Calb2 T C 8: 110,168,058 H27R possibly damaging Het
Camkk2 A C 5: 122,756,626 L201R probably damaging Het
Car15 A G 16: 17,836,716 probably null Het
Cecr2 A G 6: 120,758,116 N771S probably benign Het
Cecr6 A T 6: 120,492,761 S332T possibly damaging Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Csmd1 T A 8: 16,058,702 I1896F probably damaging Het
Cubn C T 2: 13,486,802 V145I probably benign Het
Cuedc1 G A 11: 88,182,555 S182N probably benign Het
Cux1 T A 5: 136,308,504 E718V probably damaging Het
Cyp7a1 G A 4: 6,268,295 P477S probably damaging Het
Dcaf17 T A 2: 71,055,374 W16R Het
Dhx8 T A 11: 101,740,745 M388K probably benign Het
Dnah14 T A 1: 181,716,215 Y2453* probably null Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
F830016B08Rik G A 18: 60,300,288 E148K probably benign Het
Gm15800 A G 5: 121,266,361 T434A possibly damaging Het
Gm4955 T C 1: 173,480,466 I655V Het
Ide A G 19: 37,313,553 L368P Het
Ide G C 19: 37,313,554 L368V probably null Het
Insrr A G 3: 87,814,194 M1136V probably damaging Het
Kcne2 A G 16: 92,296,819 E78G probably damaging Het
Lrrc23 A T 6: 124,778,304 L90H probably damaging Het
Magel2 A C 7: 62,379,127 Q593P unknown Het
Mrgpra3 G A 7: 47,589,720 H153Y possibly damaging Het
Msln A G 17: 25,748,906 V595A possibly damaging Het
Mvb12a T C 8: 71,543,059 probably null Het
Myo7a T G 7: 98,077,169 M966L probably benign Het
Ncoa5 C T 2: 165,013,062 D47N possibly damaging Het
Neurl4 T A 11: 69,909,380 probably null Het
Olfr389 T A 11: 73,777,013 M105L probably benign Het
Olfr464 T C 11: 87,914,763 T48A probably benign Het
Olfr501-ps1 T A 7: 108,508,918 H287Q unknown Het
Olfr884 T A 9: 38,047,704 C161S probably benign Het
Osbpl7 T A 11: 97,056,579 S480T probably benign Het
Podnl1 T C 8: 84,131,923 L484P Het
Prkaa1 G T 15: 5,177,082 V438L possibly damaging Het
Prune2 A T 19: 17,123,009 H1959L probably benign Het
Rad50 A T 11: 53,698,858 L172* probably null Het
Samsn1 C A 16: 75,888,796 G25W probably damaging Het
Sbno1 T G 5: 124,404,005 L362F probably damaging Het
Slc26a6 G A 9: 108,856,031 R43H probably benign Het
Slc35f5 T G 1: 125,562,515 Y49* probably null Het
Slc41a2 T C 10: 83,301,180 I288V probably benign Het
Slc9c1 A G 16: 45,582,981 M804V probably benign Het
Smc6 T A 12: 11,274,051 S66T probably benign Het
Sycp1 A G 3: 102,841,037 I813T probably benign Het
Treml4 A C 17: 48,274,428 I244L probably benign Het
Unc13b T A 4: 43,172,524 C1117* probably null Het
Wdr35 A G 12: 9,008,020 I526V probably benign Het
Zap70 T C 1: 36,781,137 W500R probably damaging Het
Zfr G T 15: 12,135,271 V49F noncoding transcript Het
Other mutations in Ssh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Ssh1 APN 5 113942576 missense probably damaging 1.00
IGL01432:Ssh1 APN 5 113958822 missense probably benign 0.31
IGL01933:Ssh1 APN 5 113950380 splice site probably benign
IGL01951:Ssh1 APN 5 113966247 missense possibly damaging 0.64
IGL02117:Ssh1 APN 5 113946480 nonsense probably null
IGL02391:Ssh1 APN 5 113942517 missense probably damaging 1.00
R0110:Ssh1 UTSW 5 113946705 missense probably benign 0.00
R0469:Ssh1 UTSW 5 113946705 missense probably benign 0.00
R0510:Ssh1 UTSW 5 113946705 missense probably benign 0.00
R0682:Ssh1 UTSW 5 113960657 missense probably damaging 1.00
R0863:Ssh1 UTSW 5 113966731 missense probably damaging 1.00
R0939:Ssh1 UTSW 5 113970436 missense probably damaging 1.00
R1539:Ssh1 UTSW 5 113952003 missense probably damaging 1.00
R1716:Ssh1 UTSW 5 113952020 missense possibly damaging 0.80
R1754:Ssh1 UTSW 5 113955845 missense probably damaging 0.99
R1867:Ssh1 UTSW 5 113943451 missense probably damaging 1.00
R2261:Ssh1 UTSW 5 113942703 missense possibly damaging 0.94
R2262:Ssh1 UTSW 5 113942703 missense possibly damaging 0.94
R2497:Ssh1 UTSW 5 113958858 missense probably damaging 1.00
R3774:Ssh1 UTSW 5 113966722 missense probably damaging 1.00
R3922:Ssh1 UTSW 5 113942708 missense possibly damaging 0.52
R5120:Ssh1 UTSW 5 113957398 missense possibly damaging 0.89
R5283:Ssh1 UTSW 5 113950545 missense probably damaging 1.00
R5810:Ssh1 UTSW 5 113946566 missense probably benign 0.05
R5877:Ssh1 UTSW 5 113943120 missense probably benign 0.29
R6140:Ssh1 UTSW 5 113942631 missense probably benign 0.16
R6360:Ssh1 UTSW 5 113961347 splice site probably null
R6612:Ssh1 UTSW 5 113958730 missense probably benign 0.43
R6819:Ssh1 UTSW 5 113946790 missense probably benign
R6855:Ssh1 UTSW 5 113942575 missense probably damaging 1.00
R7389:Ssh1 UTSW 5 113958831 missense probably benign 0.28
R7470:Ssh1 UTSW 5 113942427 missense possibly damaging 0.63
R7568:Ssh1 UTSW 5 113957380 splice site probably null
R7647:Ssh1 UTSW 5 113942958 missense probably benign 0.00
R7649:Ssh1 UTSW 5 113950551 missense probably benign 0.12
R7754:Ssh1 UTSW 5 113966234 missense probably benign 0.31
R7887:Ssh1 UTSW 5 113961349 critical splice donor site probably null
R8167:Ssh1 UTSW 5 113951990 missense possibly damaging 0.49
Z1177:Ssh1 UTSW 5 113966294 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ATGAAAACCTTACAGAGCTGAAAGC -3'
(R):5'- TGAAGACCGTGTGTTACACC -3'

Sequencing Primer
(F):5'- GCTAGTCAGCTTTTGTTTACCCTCG -3'
(R):5'- AGCATCCACAGCGTCCGAG -3'
Posted On2020-07-28