Incidental Mutation 'R8289:Cecr2'
ID638571
Institutional Source Beutler Lab
Gene Symbol Cecr2
Ensembl Gene ENSMUSG00000071226
Gene NameCECR2, histone acetyl-lysine reader
SynonymsGtl4, 2610101O16Rik, 2810409N01Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8289 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location120666369-120771190 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120758116 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 771 (N771S)
Ref Sequence ENSEMBL: ENSMUSP00000098556 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100993] [ENSMUST00000112686] [ENSMUST00000129803]
Predicted Effect probably benign
Transcript: ENSMUST00000100993
AA Change: N771S

PolyPhen 2 Score 0.240 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000098556
Gene: ENSMUSG00000071226
AA Change: N771S

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
low complexity region 194 209 N/A INTRINSIC
low complexity region 211 222 N/A INTRINSIC
Pfam:WHIM3 244 284 5.2e-11 PFAM
coiled coil region 322 382 N/A INTRINSIC
BROMO 416 520 5.09e-32 SMART
low complexity region 536 551 N/A INTRINSIC
low complexity region 781 796 N/A INTRINSIC
low complexity region 839 855 N/A INTRINSIC
low complexity region 890 907 N/A INTRINSIC
low complexity region 1173 1187 N/A INTRINSIC
low complexity region 1202 1223 N/A INTRINSIC
low complexity region 1355 1366 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112686
AA Change: N743S

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000108306
Gene: ENSMUSG00000071226
AA Change: N743S

DomainStartEndE-ValueType
low complexity region 4 14 N/A INTRINSIC
low complexity region 194 209 N/A INTRINSIC
low complexity region 211 222 N/A INTRINSIC
coiled coil region 322 382 N/A INTRINSIC
BROMO 416 520 5.09e-32 SMART
low complexity region 536 551 N/A INTRINSIC
low complexity region 753 768 N/A INTRINSIC
low complexity region 811 827 N/A INTRINSIC
low complexity region 862 879 N/A INTRINSIC
low complexity region 1145 1159 N/A INTRINSIC
low complexity region 1174 1195 N/A INTRINSIC
low complexity region 1327 1338 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129803
SMART Domains Protein: ENSMUSP00000118542
Gene: ENSMUSG00000071226

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
coiled coil region 90 150 N/A INTRINSIC
Pfam:Bromodomain 191 234 1.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143563
SMART Domains Protein: ENSMUSP00000116993
Gene: ENSMUSG00000071226

DomainStartEndE-ValueType
low complexity region 5 20 N/A INTRINSIC
low complexity region 63 79 N/A INTRINSIC
low complexity region 114 131 N/A INTRINSIC
low complexity region 155 174 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a bromodomain-containing protein that is involved in chromatin remodeling, and may additionally play a role in DNA damage response. The encoded protein functions as part of an ATP-dependent complex that is involved in neurulation. This gene is a candidate gene for Cat Eye Syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutant mice display varied penetrance of exencephaly depending on genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 C A 5: 89,775,423 D175Y possibly damaging Het
Adra1b G A 11: 43,835,488 P201S probably damaging Het
Ahnak2 A G 12: 112,775,808 V610A possibly damaging Het
Ap5s1 A C 2: 131,212,459 H62P probably benign Het
Apeh A G 9: 108,086,245 S593P probably damaging Het
Arhgap24 T C 5: 102,880,826 V289A possibly damaging Het
Atoh1 A G 6: 64,729,909 E196G probably damaging Het
Atp1b3 G A 9: 96,333,549 S271L probably benign Het
Atp6v0a1 A G 11: 101,034,105 R339G probably damaging Het
Calb2 T C 8: 110,168,058 H27R possibly damaging Het
Camkk2 A C 5: 122,756,626 L201R probably damaging Het
Car15 A G 16: 17,836,716 probably null Het
Cecr6 A T 6: 120,492,761 S332T possibly damaging Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Csmd1 T A 8: 16,058,702 I1896F probably damaging Het
Cubn C T 2: 13,486,802 V145I probably benign Het
Cuedc1 G A 11: 88,182,555 S182N probably benign Het
Cux1 T A 5: 136,308,504 E718V probably damaging Het
Cyp7a1 G A 4: 6,268,295 P477S probably damaging Het
Dcaf17 T A 2: 71,055,374 W16R Het
Dhx8 T A 11: 101,740,745 M388K probably benign Het
Dnah14 T A 1: 181,716,215 Y2453* probably null Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
F830016B08Rik G A 18: 60,300,288 E148K probably benign Het
Gm15800 A G 5: 121,266,361 T434A possibly damaging Het
Gm4955 T C 1: 173,480,466 I655V Het
Ide A G 19: 37,313,553 L368P Het
Ide G C 19: 37,313,554 L368V probably null Het
Insrr A G 3: 87,814,194 M1136V probably damaging Het
Kcne2 A G 16: 92,296,819 E78G probably damaging Het
Lrrc23 A T 6: 124,778,304 L90H probably damaging Het
Magel2 A C 7: 62,379,127 Q593P unknown Het
Mrgpra3 G A 7: 47,589,720 H153Y possibly damaging Het
Msln A G 17: 25,748,906 V595A possibly damaging Het
Mvb12a T C 8: 71,543,059 probably null Het
Myo7a T G 7: 98,077,169 M966L probably benign Het
Ncoa5 C T 2: 165,013,062 D47N possibly damaging Het
Neurl4 T A 11: 69,909,380 probably null Het
Olfr389 T A 11: 73,777,013 M105L probably benign Het
Olfr464 T C 11: 87,914,763 T48A probably benign Het
Olfr501-ps1 T A 7: 108,508,918 H287Q unknown Het
Olfr884 T A 9: 38,047,704 C161S probably benign Het
Osbpl7 T A 11: 97,056,579 S480T probably benign Het
Podnl1 T C 8: 84,131,923 L484P Het
Prkaa1 G T 15: 5,177,082 V438L possibly damaging Het
Prune2 A T 19: 17,123,009 H1959L probably benign Het
Rad50 A T 11: 53,698,858 L172* probably null Het
Samsn1 C A 16: 75,888,796 G25W probably damaging Het
Sbno1 T G 5: 124,404,005 L362F probably damaging Het
Slc26a6 G A 9: 108,856,031 R43H probably benign Het
Slc35f5 T G 1: 125,562,515 Y49* probably null Het
Slc41a2 T C 10: 83,301,180 I288V probably benign Het
Slc9c1 A G 16: 45,582,981 M804V probably benign Het
Smc6 T A 12: 11,274,051 S66T probably benign Het
Ssh1 T C 5: 113,942,384 D995G probably benign Het
Sycp1 A G 3: 102,841,037 I813T probably benign Het
Treml4 A C 17: 48,274,428 I244L probably benign Het
Unc13b T A 4: 43,172,524 C1117* probably null Het
Wdr35 A G 12: 9,008,020 I526V probably benign Het
Zap70 T C 1: 36,781,137 W500R probably damaging Het
Zfr G T 15: 12,135,271 V49F noncoding transcript Het
Other mutations in Cecr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Cecr2 APN 6 120756717 missense probably damaging 1.00
IGL00782:Cecr2 APN 6 120761621 missense probably benign 0.00
IGL01137:Cecr2 APN 6 120762028 missense probably damaging 1.00
IGL01446:Cecr2 APN 6 120758599 missense probably benign
IGL02108:Cecr2 APN 6 120762558 critical splice donor site probably null
IGL02195:Cecr2 APN 6 120731406 missense probably damaging 1.00
IGL02689:Cecr2 APN 6 120762167 missense probably damaging 1.00
IGL03189:Cecr2 APN 6 120762430 missense probably benign 0.13
PIT1430001:Cecr2 UTSW 6 120758479 missense probably benign 0.01
R0200:Cecr2 UTSW 6 120761797 missense probably damaging 1.00
R0586:Cecr2 UTSW 6 120757884 missense probably damaging 1.00
R0715:Cecr2 UTSW 6 120758198 missense probably benign 0.21
R0784:Cecr2 UTSW 6 120758149 missense possibly damaging 0.74
R1185:Cecr2 UTSW 6 120758205 nonsense probably null
R1185:Cecr2 UTSW 6 120758205 nonsense probably null
R1185:Cecr2 UTSW 6 120758205 nonsense probably null
R1343:Cecr2 UTSW 6 120754711 missense probably damaging 0.99
R1349:Cecr2 UTSW 6 120757603 missense probably damaging 0.99
R1386:Cecr2 UTSW 6 120762131 missense probably damaging 1.00
R1438:Cecr2 UTSW 6 120761472 nonsense probably null
R1602:Cecr2 UTSW 6 120755587 missense possibly damaging 0.52
R1664:Cecr2 UTSW 6 120762026 missense probably damaging 0.96
R1731:Cecr2 UTSW 6 120758180 missense possibly damaging 0.74
R1817:Cecr2 UTSW 6 120731267 missense probably damaging 1.00
R1818:Cecr2 UTSW 6 120731267 missense probably damaging 1.00
R1819:Cecr2 UTSW 6 120731267 missense probably damaging 1.00
R1862:Cecr2 UTSW 6 120757941 missense probably damaging 1.00
R1907:Cecr2 UTSW 6 120761160 missense probably benign 0.03
R1911:Cecr2 UTSW 6 120762565 unclassified probably benign
R2135:Cecr2 UTSW 6 120720962 missense probably damaging 1.00
R2273:Cecr2 UTSW 6 120756741 missense probably benign 0.00
R2275:Cecr2 UTSW 6 120756741 missense probably benign 0.00
R3713:Cecr2 UTSW 6 120758260 missense probably damaging 1.00
R4271:Cecr2 UTSW 6 120762475 missense probably damaging 1.00
R4706:Cecr2 UTSW 6 120755578 missense possibly damaging 0.73
R4873:Cecr2 UTSW 6 120750916 missense probably damaging 0.99
R4875:Cecr2 UTSW 6 120750916 missense probably damaging 0.99
R5137:Cecr2 UTSW 6 120755517 missense probably benign
R5153:Cecr2 UTSW 6 120734560 missense probably benign 0.03
R5377:Cecr2 UTSW 6 120756569 missense possibly damaging 0.87
R5598:Cecr2 UTSW 6 120731446 splice site probably null
R5651:Cecr2 UTSW 6 120755560 missense probably damaging 0.96
R5680:Cecr2 UTSW 6 120761426 missense probably benign
R5813:Cecr2 UTSW 6 120762208 missense probably damaging 0.99
R5970:Cecr2 UTSW 6 120720907 missense probably damaging 0.98
R6255:Cecr2 UTSW 6 120758050 missense probably damaging 1.00
R6266:Cecr2 UTSW 6 120761686 missense probably benign
R6630:Cecr2 UTSW 6 120762178 missense probably damaging 1.00
R6737:Cecr2 UTSW 6 120737123 missense possibly damaging 0.86
R6754:Cecr2 UTSW 6 120757578 missense probably damaging 0.98
R6807:Cecr2 UTSW 6 120734542 splice site probably null
R7187:Cecr2 UTSW 6 120756686 missense probably benign
R7256:Cecr2 UTSW 6 120762529 missense probably benign
R7282:Cecr2 UTSW 6 120761621 missense
R7548:Cecr2 UTSW 6 120761714 missense
R7596:Cecr2 UTSW 6 120762206 missense probably benign
R7802:Cecr2 UTSW 6 120743847 missense probably benign 0.45
R8112:Cecr2 UTSW 6 120762214 missense probably benign 0.00
R8294:Cecr2 UTSW 6 120733786 missense probably damaging 0.99
X0012:Cecr2 UTSW 6 120733774 missense probably damaging 0.99
X0063:Cecr2 UTSW 6 120762071 missense probably benign 0.01
Z1177:Cecr2 UTSW 6 120720962 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTACAGCTTGGGCAGATG -3'
(R):5'- TGCATATACCCCGAGGAAGG -3'

Sequencing Primer
(F):5'- GGCAGATGAATTGTCCCAGTC -3'
(R):5'- CCCGAGGAAGGAACTCCATG -3'
Posted On2020-07-28