Incidental Mutation 'R8289:Olfr389'
ID638589
Institutional Source Beutler Lab
Gene Symbol Olfr389
Ensembl Gene ENSMUSG00000070383
Gene Nameolfactory receptor 389
SynonymsMOR135-6, GA_x6K02T2P1NL-3932085-3931147
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R8289 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location73774849-73780713 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 73777013 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 105 (M105L)
Ref Sequence ENSEMBL: ENSMUSP00000113364 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122224] [ENSMUST00000124927]
Predicted Effect probably benign
Transcript: ENSMUST00000122224
AA Change: M105L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113364
Gene: ENSMUSG00000070383
AA Change: M105L

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.8e-56 PFAM
Pfam:7TM_GPCR_Srsx 35 305 4.2e-6 PFAM
Pfam:7tm_1 41 290 2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124927
AA Change: M105L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000115639
Gene: ENSMUSG00000070383
AA Change: M105L

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 35 221 6.6e-7 PFAM
Pfam:7tm_1 41 224 3.5e-29 PFAM
Pfam:7tm_4 139 224 1.4e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 C A 5: 89,775,423 D175Y possibly damaging Het
Adra1b G A 11: 43,835,488 P201S probably damaging Het
Ahnak2 A G 12: 112,775,808 V610A possibly damaging Het
Ap5s1 A C 2: 131,212,459 H62P probably benign Het
Apeh A G 9: 108,086,245 S593P probably damaging Het
Arhgap24 T C 5: 102,880,826 V289A possibly damaging Het
Atoh1 A G 6: 64,729,909 E196G probably damaging Het
Atp1b3 G A 9: 96,333,549 S271L probably benign Het
Atp6v0a1 A G 11: 101,034,105 R339G probably damaging Het
Calb2 T C 8: 110,168,058 H27R possibly damaging Het
Camkk2 A C 5: 122,756,626 L201R probably damaging Het
Car15 A G 16: 17,836,716 probably null Het
Cecr2 A G 6: 120,758,116 N771S probably benign Het
Cecr6 A T 6: 120,492,761 S332T possibly damaging Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Csmd1 T A 8: 16,058,702 I1896F probably damaging Het
Cubn C T 2: 13,486,802 V145I probably benign Het
Cuedc1 G A 11: 88,182,555 S182N probably benign Het
Cux1 T A 5: 136,308,504 E718V probably damaging Het
Cyp7a1 G A 4: 6,268,295 P477S probably damaging Het
Dcaf17 T A 2: 71,055,374 W16R Het
Dhx8 T A 11: 101,740,745 M388K probably benign Het
Dnah14 T A 1: 181,716,215 Y2453* probably null Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
F830016B08Rik G A 18: 60,300,288 E148K probably benign Het
Gm15800 A G 5: 121,266,361 T434A possibly damaging Het
Gm4955 T C 1: 173,480,466 I655V Het
Ide A G 19: 37,313,553 L368P Het
Ide G C 19: 37,313,554 L368V probably null Het
Insrr A G 3: 87,814,194 M1136V probably damaging Het
Kcne2 A G 16: 92,296,819 E78G probably damaging Het
Lrrc23 A T 6: 124,778,304 L90H probably damaging Het
Magel2 A C 7: 62,379,127 Q593P unknown Het
Mrgpra3 G A 7: 47,589,720 H153Y possibly damaging Het
Msln A G 17: 25,748,906 V595A possibly damaging Het
Mvb12a T C 8: 71,543,059 probably null Het
Myo7a T G 7: 98,077,169 M966L probably benign Het
Ncoa5 C T 2: 165,013,062 D47N possibly damaging Het
Neurl4 T A 11: 69,909,380 probably null Het
Olfr464 T C 11: 87,914,763 T48A probably benign Het
Olfr501-ps1 T A 7: 108,508,918 H287Q unknown Het
Olfr884 T A 9: 38,047,704 C161S probably benign Het
Osbpl7 T A 11: 97,056,579 S480T probably benign Het
Podnl1 T C 8: 84,131,923 L484P Het
Prkaa1 G T 15: 5,177,082 V438L possibly damaging Het
Prune2 A T 19: 17,123,009 H1959L probably benign Het
Rad50 A T 11: 53,698,858 L172* probably null Het
Samsn1 C A 16: 75,888,796 G25W probably damaging Het
Sbno1 T G 5: 124,404,005 L362F probably damaging Het
Slc26a6 G A 9: 108,856,031 R43H probably benign Het
Slc35f5 T G 1: 125,562,515 Y49* probably null Het
Slc41a2 T C 10: 83,301,180 I288V probably benign Het
Slc9c1 A G 16: 45,582,981 M804V probably benign Het
Smc6 T A 12: 11,274,051 S66T probably benign Het
Ssh1 T C 5: 113,942,384 D995G probably benign Het
Sycp1 A G 3: 102,841,037 I813T probably benign Het
Treml4 A C 17: 48,274,428 I244L probably benign Het
Unc13b T A 4: 43,172,524 C1117* probably null Het
Wdr35 A G 12: 9,008,020 I526V probably benign Het
Zap70 T C 1: 36,781,137 W500R probably damaging Het
Zfr G T 15: 12,135,271 V49F noncoding transcript Het
Other mutations in Olfr389
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01458:Olfr389 APN 11 73776706 missense probably benign 0.44
IGL01766:Olfr389 APN 11 73777075 missense probably benign 0.41
IGL01771:Olfr389 APN 11 73776664 missense probably damaging 1.00
IGL02535:Olfr389 APN 11 73776616 missense probably benign 0.00
IGL02639:Olfr389 APN 11 73776545 missense probably benign 0.21
IGL03060:Olfr389 APN 11 73776463 missense probably damaging 1.00
IGL03075:Olfr389 APN 11 73776472 missense probably damaging 1.00
R0081:Olfr389 UTSW 11 73777109 missense possibly damaging 0.59
R0426:Olfr389 UTSW 11 73776437 missense probably benign 0.13
R1140:Olfr389 UTSW 11 73776854 missense probably benign
R1638:Olfr389 UTSW 11 73777148 missense possibly damaging 0.95
R2001:Olfr389 UTSW 11 73776713 missense probably benign
R2214:Olfr389 UTSW 11 73776829 nonsense probably null
R3076:Olfr389 UTSW 11 73776640 missense possibly damaging 0.93
R3077:Olfr389 UTSW 11 73776640 missense possibly damaging 0.93
R3078:Olfr389 UTSW 11 73776640 missense possibly damaging 0.93
R3081:Olfr389 UTSW 11 73777225 missense probably damaging 1.00
R3430:Olfr389 UTSW 11 73776539 missense probably damaging 1.00
R3731:Olfr389 UTSW 11 73776739 missense probably benign 0.08
R4090:Olfr389 UTSW 11 73776841 missense probably damaging 1.00
R4303:Olfr389 UTSW 11 73776838 missense possibly damaging 0.78
R4516:Olfr389 UTSW 11 73777040 missense probably benign 0.06
R4556:Olfr389 UTSW 11 73776481 missense possibly damaging 0.65
R4557:Olfr389 UTSW 11 73776481 missense possibly damaging 0.65
R4775:Olfr389 UTSW 11 73776551 missense probably damaging 1.00
R4858:Olfr389 UTSW 11 73776546 missense probably benign 0.44
R5015:Olfr389 UTSW 11 73777181 missense probably benign 0.07
R5087:Olfr389 UTSW 11 73777258 missense possibly damaging 0.75
R6599:Olfr389 UTSW 11 73776680 missense probably benign
R6701:Olfr389 UTSW 11 73776470 missense probably damaging 1.00
R6784:Olfr389 UTSW 11 73776850 missense probably damaging 1.00
R6916:Olfr389 UTSW 11 73777069 missense probably benign 0.00
R7066:Olfr389 UTSW 11 73777192 missense probably damaging 0.99
R7226:Olfr389 UTSW 11 73776677 missense possibly damaging 0.95
R7457:Olfr389 UTSW 11 73776826 missense probably benign 0.06
R7486:Olfr389 UTSW 11 73777021 missense probably damaging 1.00
R7990:Olfr389 UTSW 11 73776671 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTCAGAAGAGCAGAAATGTCAC -3'
(R):5'- GCCCTTGTTCGACTGGATTC -3'

Sequencing Primer
(F):5'- TTCTTCTCACAAAAAGACAATCTAGC -3'
(R):5'- GACTGGATTCCCATCTCCACAC -3'
Posted On2020-07-28