Incidental Mutation 'R0708:Slc24a1'
ID63859
Institutional Source Beutler Lab
Gene Symbol Slc24a1
Ensembl Gene ENSMUSG00000034452
Gene Namesolute carrier family 24 (sodium/potassium/calcium exchanger), member 1
Synonyms
MMRRC Submission 038891-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R0708 (G1)
Quality Score198
Status Not validated
Chromosome9
Chromosomal Location64922861-64951607 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 64947890 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 578 (K578N)
Ref Sequence ENSEMBL: ENSMUSP00000035616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037798]
Predicted Effect unknown
Transcript: ENSMUST00000037798
AA Change: K578N
SMART Domains Protein: ENSMUSP00000035616
Gene: ENSMUSG00000034452
AA Change: K578N

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Na_Ca_ex 425 569 1.7e-28 PFAM
low complexity region 683 699 N/A INTRINSIC
coiled coil region 747 776 N/A INTRINSIC
coiled coil region 818 847 N/A INTRINSIC
coiled coil region 898 928 N/A INTRINSIC
transmembrane domain 939 956 N/A INTRINSIC
Pfam:Na_Ca_ex 967 1118 1.7e-33 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the potassium-dependent sodium/calcium exchanger protein family. The encoded protein plays an important role in sodium/calcium exchange in retinal rod and cone photoreceptors by mediating the extrusion of one calcium ion and one potassium ion in exchange for four sodium ions. Mutations in this gene may play a role in congenital stationary night blindness. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a null allele display slow progressive retinal degeneration and develop stationary night blindness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brdt A T 5: 107,358,900 K450* probably null Het
Cand2 G A 6: 115,803,805 E1217K probably damaging Het
Col9a1 A T 1: 24,237,261 Q750L possibly damaging Het
Dnah6 A T 6: 73,212,622 S14R probably benign Het
Enox1 A G 14: 77,592,912 N319S probably benign Het
Frs2 G A 10: 117,074,092 T455M probably damaging Het
Glra3 C T 8: 56,125,364 probably benign Het
Gmppa T C 1: 75,442,574 F375S probably damaging Het
Hectd4 G A 5: 121,286,463 probably null Het
Hgf C A 5: 16,566,763 C129* probably null Het
Insc T A 7: 114,845,146 V456E probably damaging Het
Ints14 G A 9: 64,983,984 V416I probably benign Het
Klk1b11 T C 7: 43,997,728 F29L possibly damaging Het
Ogfod1 C T 8: 94,039,045 L79F possibly damaging Het
Olfr926 T A 9: 38,877,275 V33E probably damaging Het
Orc3 A T 4: 34,597,368 I224N probably damaging Het
Papss2 T C 19: 32,637,216 F111L probably damaging Het
Poc1b A G 10: 99,155,130 D291G probably null Het
Prl8a8 A T 13: 27,511,545 M72K possibly damaging Het
Ptpn7 C A 1: 135,134,547 T77K probably damaging Het
Ptpro T C 6: 137,386,253 S462P probably benign Het
Rab3gap2 T A 1: 185,249,926 S392T probably damaging Het
Sema4d A G 13: 51,712,719 V245A probably benign Het
Sgcb A T 5: 73,640,882 probably null Het
Sptbn1 A T 11: 30,114,739 V1920E probably damaging Het
Tecr A T 8: 83,573,109 I101N probably damaging Het
Tectb T C 19: 55,191,552 F277L probably benign Het
Tgs1 T A 4: 3,586,152 L343H probably benign Het
Thbs4 C A 13: 92,773,186 G368W probably damaging Het
Zfp558 T C 9: 18,456,827 S222G possibly damaging Het
Other mutations in Slc24a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Slc24a1 APN 9 64928019 missense probably damaging 0.99
IGL01602:Slc24a1 APN 9 64926181 missense probably damaging 1.00
IGL03111:Slc24a1 APN 9 64926326 missense probably damaging 0.98
R0092:Slc24a1 UTSW 9 64948752 missense unknown
R0827:Slc24a1 UTSW 9 64928190 missense probably benign 0.03
R1294:Slc24a1 UTSW 9 64936013 missense unknown
R1613:Slc24a1 UTSW 9 64948696 missense unknown
R2858:Slc24a1 UTSW 9 64949332 missense unknown
R3779:Slc24a1 UTSW 9 64948297 missense unknown
R3899:Slc24a1 UTSW 9 64928144 missense probably damaging 0.99
R3900:Slc24a1 UTSW 9 64928144 missense probably damaging 0.99
R4409:Slc24a1 UTSW 9 64948224 missense probably benign 0.39
R4732:Slc24a1 UTSW 9 64949554 missense probably benign 0.23
R4733:Slc24a1 UTSW 9 64949554 missense probably benign 0.23
R4745:Slc24a1 UTSW 9 64949476 missense unknown
R4915:Slc24a1 UTSW 9 64947931 missense unknown
R5371:Slc24a1 UTSW 9 64949268 missense unknown
R5448:Slc24a1 UTSW 9 64948327 missense probably benign 0.39
R5540:Slc24a1 UTSW 9 64948581 missense unknown
R5863:Slc24a1 UTSW 9 64928542 missense unknown
R6161:Slc24a1 UTSW 9 64937263 missense unknown
R6810:Slc24a1 UTSW 9 64948323 missense probably benign 0.39
R7215:Slc24a1 UTSW 9 64928503 missense unknown
R7380:Slc24a1 UTSW 9 64948533 missense unknown
R7453:Slc24a1 UTSW 9 64949301 missense unknown
R7466:Slc24a1 UTSW 9 64928404 missense unknown
R7488:Slc24a1 UTSW 9 64924482 missense probably benign 0.41
R7672:Slc24a1 UTSW 9 64947927 missense unknown
X0063:Slc24a1 UTSW 9 64949143 missense unknown
Predicted Primers PCR Primer
(F):5'- CCGGCTCAAATGGCATTTCCAGAC -3'
(R):5'- TGGGCTCTGCTGTGTTCAACATC -3'

Sequencing Primer
(F):5'- tccactgcctgcttgcc -3'
(R):5'- TGTCATCGGCACCTGTG -3'
Posted On2013-07-30