Incidental Mutation 'R8289:Cuedc1'
ID638591
Institutional Source Beutler Lab
Gene Symbol Cuedc1
Ensembl Gene ENSMUSG00000018378
Gene NameCUE domain containing 1
SynonymsC330016O16Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8289 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location88098058-88194140 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 88182555 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 182 (S182N)
Ref Sequence ENSEMBL: ENSMUSP00000018522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018522] [ENSMUST00000154812]
Predicted Effect probably benign
Transcript: ENSMUST00000018522
AA Change: S182N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000018522
Gene: ENSMUSG00000018378
AA Change: S182N

DomainStartEndE-ValueType
low complexity region 6 33 N/A INTRINSIC
CUE 50 92 6.55e-15 SMART
low complexity region 94 110 N/A INTRINSIC
low complexity region 121 136 N/A INTRINSIC
low complexity region 207 222 N/A INTRINSIC
low complexity region 331 340 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154812
AA Change: S182N

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000120867
Gene: ENSMUSG00000018378
AA Change: S182N

DomainStartEndE-ValueType
low complexity region 6 33 N/A INTRINSIC
CUE 50 92 6.55e-15 SMART
low complexity region 94 110 N/A INTRINSIC
low complexity region 121 136 N/A INTRINSIC
low complexity region 207 222 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 C A 5: 89,775,423 D175Y possibly damaging Het
Adra1b G A 11: 43,835,488 P201S probably damaging Het
Ahnak2 A G 12: 112,775,808 V610A possibly damaging Het
Ap5s1 A C 2: 131,212,459 H62P probably benign Het
Apeh A G 9: 108,086,245 S593P probably damaging Het
Arhgap24 T C 5: 102,880,826 V289A possibly damaging Het
Atoh1 A G 6: 64,729,909 E196G probably damaging Het
Atp1b3 G A 9: 96,333,549 S271L probably benign Het
Atp6v0a1 A G 11: 101,034,105 R339G probably damaging Het
Calb2 T C 8: 110,168,058 H27R possibly damaging Het
Camkk2 A C 5: 122,756,626 L201R probably damaging Het
Car15 A G 16: 17,836,716 probably null Het
Cecr2 A G 6: 120,758,116 N771S probably benign Het
Cecr6 A T 6: 120,492,761 S332T possibly damaging Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Csmd1 T A 8: 16,058,702 I1896F probably damaging Het
Cubn C T 2: 13,486,802 V145I probably benign Het
Cux1 T A 5: 136,308,504 E718V probably damaging Het
Cyp7a1 G A 4: 6,268,295 P477S probably damaging Het
Dcaf17 T A 2: 71,055,374 W16R Het
Dhx8 T A 11: 101,740,745 M388K probably benign Het
Dnah14 T A 1: 181,716,215 Y2453* probably null Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
F830016B08Rik G A 18: 60,300,288 E148K probably benign Het
Gm15800 A G 5: 121,266,361 T434A possibly damaging Het
Gm4955 T C 1: 173,480,466 I655V Het
Ide A G 19: 37,313,553 L368P Het
Ide G C 19: 37,313,554 L368V probably null Het
Insrr A G 3: 87,814,194 M1136V probably damaging Het
Kcne2 A G 16: 92,296,819 E78G probably damaging Het
Lrrc23 A T 6: 124,778,304 L90H probably damaging Het
Magel2 A C 7: 62,379,127 Q593P unknown Het
Mrgpra3 G A 7: 47,589,720 H153Y possibly damaging Het
Msln A G 17: 25,748,906 V595A possibly damaging Het
Mvb12a T C 8: 71,543,059 probably null Het
Myo7a T G 7: 98,077,169 M966L probably benign Het
Ncoa5 C T 2: 165,013,062 D47N possibly damaging Het
Neurl4 T A 11: 69,909,380 probably null Het
Olfr389 T A 11: 73,777,013 M105L probably benign Het
Olfr464 T C 11: 87,914,763 T48A probably benign Het
Olfr501-ps1 T A 7: 108,508,918 H287Q unknown Het
Olfr884 T A 9: 38,047,704 C161S probably benign Het
Osbpl7 T A 11: 97,056,579 S480T probably benign Het
Podnl1 T C 8: 84,131,923 L484P Het
Prkaa1 G T 15: 5,177,082 V438L possibly damaging Het
Prune2 A T 19: 17,123,009 H1959L probably benign Het
Rad50 A T 11: 53,698,858 L172* probably null Het
Samsn1 C A 16: 75,888,796 G25W probably damaging Het
Sbno1 T G 5: 124,404,005 L362F probably damaging Het
Slc26a6 G A 9: 108,856,031 R43H probably benign Het
Slc35f5 T G 1: 125,562,515 Y49* probably null Het
Slc41a2 T C 10: 83,301,180 I288V probably benign Het
Slc9c1 A G 16: 45,582,981 M804V probably benign Het
Smc6 T A 12: 11,274,051 S66T probably benign Het
Ssh1 T C 5: 113,942,384 D995G probably benign Het
Sycp1 A G 3: 102,841,037 I813T probably benign Het
Treml4 A C 17: 48,274,428 I244L probably benign Het
Unc13b T A 4: 43,172,524 C1117* probably null Het
Wdr35 A G 12: 9,008,020 I526V probably benign Het
Zap70 T C 1: 36,781,137 W500R probably damaging Het
Zfr G T 15: 12,135,271 V49F noncoding transcript Het
Other mutations in Cuedc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01129:Cuedc1 APN 11 88183254 missense possibly damaging 0.56
IGL02103:Cuedc1 APN 11 88188799 missense probably damaging 0.99
IGL02325:Cuedc1 APN 11 88170173 missense probably null 1.00
IGL03001:Cuedc1 APN 11 88182489 missense probably benign 0.02
IGL03245:Cuedc1 APN 11 88177262 splice site probably benign
R0242:Cuedc1 UTSW 11 88184621 splice site probably benign
R0511:Cuedc1 UTSW 11 88183405 missense probably damaging 1.00
R1013:Cuedc1 UTSW 11 88188027 missense possibly damaging 0.68
R1382:Cuedc1 UTSW 11 88177363 missense probably benign 0.08
R2004:Cuedc1 UTSW 11 88177390 missense probably damaging 1.00
R5320:Cuedc1 UTSW 11 88177310 missense probably damaging 1.00
R5381:Cuedc1 UTSW 11 88187986 splice site probably null
R5782:Cuedc1 UTSW 11 88170032 missense probably damaging 1.00
R6282:Cuedc1 UTSW 11 88183402 missense probably damaging 1.00
R6918:Cuedc1 UTSW 11 88187073 missense probably benign 0.00
R7329:Cuedc1 UTSW 11 88169866 missense unknown
R7985:Cuedc1 UTSW 11 88182516 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TGAGCAAGATCTCCATCTGC -3'
(R):5'- AAGCGAGGCTGTAGGTTTGC -3'

Sequencing Primer
(F):5'- AGATCTCCATCTGCCCAAGGG -3'
(R):5'- AGAAGCAGCCCAGCCTGAG -3'
Posted On2020-07-28