Incidental Mutation 'R8289:Samsn1'
ID638603
Institutional Source Beutler Lab
Gene Symbol Samsn1
Ensembl Gene ENSMUSG00000022876
Gene NameSAM domain, SH3 domain and nuclear localization signals, 1
Synonyms4930571B16Rik, Hacs1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8289 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location75858793-76022281 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 75888796 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Tryptophan at position 25 (G25W)
Ref Sequence ENSEMBL: ENSMUSP00000109877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114239] [ENSMUST00000114240]
PDB Structure
Solution structure of the Sterile Alpha Motif (SAM) domain of mouse SAMSN1 [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000114239
AA Change: G25W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109877
Gene: ENSMUSG00000022876
AA Change: G25W

DomainStartEndE-ValueType
Pfam:SLY 17 164 4.7e-57 PFAM
SH3 166 223 8.78e-4 SMART
SAM 238 305 7.6e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114240
AA Change: G154W
SMART Domains Protein: ENSMUSP00000109878
Gene: ENSMUSG00000022876
AA Change: G154W

DomainStartEndE-ValueType
low complexity region 69 80 N/A INTRINSIC
Pfam:SLY 146 293 1.1e-55 PFAM
SH3 295 352 8.78e-4 SMART
SAM 367 434 7.6e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SAMSN1 is a member of a novel gene family of putative adaptors and scaffold proteins containing SH3 and SAM (sterile alpha motif) domains (Claudio et al., 2001 [PubMed 11536050]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanced adaptive immunity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 C A 5: 89,775,423 D175Y possibly damaging Het
Adra1b G A 11: 43,835,488 P201S probably damaging Het
Ahnak2 A G 12: 112,775,808 V610A possibly damaging Het
Ap5s1 A C 2: 131,212,459 H62P probably benign Het
Apeh A G 9: 108,086,245 S593P probably damaging Het
Arhgap24 T C 5: 102,880,826 V289A possibly damaging Het
Atoh1 A G 6: 64,729,909 E196G probably damaging Het
Atp1b3 G A 9: 96,333,549 S271L probably benign Het
Atp6v0a1 A G 11: 101,034,105 R339G probably damaging Het
Calb2 T C 8: 110,168,058 H27R possibly damaging Het
Camkk2 A C 5: 122,756,626 L201R probably damaging Het
Car15 A G 16: 17,836,716 probably null Het
Cecr2 A G 6: 120,758,116 N771S probably benign Het
Cecr6 A T 6: 120,492,761 S332T possibly damaging Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Csmd1 T A 8: 16,058,702 I1896F probably damaging Het
Cubn C T 2: 13,486,802 V145I probably benign Het
Cuedc1 G A 11: 88,182,555 S182N probably benign Het
Cux1 T A 5: 136,308,504 E718V probably damaging Het
Cyp7a1 G A 4: 6,268,295 P477S probably damaging Het
Dcaf17 T A 2: 71,055,374 W16R Het
Dhx8 T A 11: 101,740,745 M388K probably benign Het
Dnah14 T A 1: 181,716,215 Y2453* probably null Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
F830016B08Rik G A 18: 60,300,288 E148K probably benign Het
Gm15800 A G 5: 121,266,361 T434A possibly damaging Het
Gm4955 T C 1: 173,480,466 I655V Het
Ide A G 19: 37,313,553 L368P Het
Ide G C 19: 37,313,554 L368V probably null Het
Insrr A G 3: 87,814,194 M1136V probably damaging Het
Kcne2 A G 16: 92,296,819 E78G probably damaging Het
Lrrc23 A T 6: 124,778,304 L90H probably damaging Het
Magel2 A C 7: 62,379,127 Q593P unknown Het
Mrgpra3 G A 7: 47,589,720 H153Y possibly damaging Het
Msln A G 17: 25,748,906 V595A possibly damaging Het
Mvb12a T C 8: 71,543,059 probably null Het
Myo7a T G 7: 98,077,169 M966L probably benign Het
Ncoa5 C T 2: 165,013,062 D47N possibly damaging Het
Neurl4 T A 11: 69,909,380 probably null Het
Olfr389 T A 11: 73,777,013 M105L probably benign Het
Olfr464 T C 11: 87,914,763 T48A probably benign Het
Olfr501-ps1 T A 7: 108,508,918 H287Q unknown Het
Olfr884 T A 9: 38,047,704 C161S probably benign Het
Osbpl7 T A 11: 97,056,579 S480T probably benign Het
Podnl1 T C 8: 84,131,923 L484P Het
Prkaa1 G T 15: 5,177,082 V438L possibly damaging Het
Prune2 A T 19: 17,123,009 H1959L probably benign Het
Rad50 A T 11: 53,698,858 L172* probably null Het
Sbno1 T G 5: 124,404,005 L362F probably damaging Het
Slc26a6 G A 9: 108,856,031 R43H probably benign Het
Slc35f5 T G 1: 125,562,515 Y49* probably null Het
Slc41a2 T C 10: 83,301,180 I288V probably benign Het
Slc9c1 A G 16: 45,582,981 M804V probably benign Het
Smc6 T A 12: 11,274,051 S66T probably benign Het
Ssh1 T C 5: 113,942,384 D995G probably benign Het
Sycp1 A G 3: 102,841,037 I813T probably benign Het
Treml4 A C 17: 48,274,428 I244L probably benign Het
Unc13b T A 4: 43,172,524 C1117* probably null Het
Wdr35 A G 12: 9,008,020 I526V probably benign Het
Zap70 T C 1: 36,781,137 W500R probably damaging Het
Zfr G T 15: 12,135,271 V49F noncoding transcript Het
Other mutations in Samsn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Samsn1 APN 16 75909120 splice site probably benign
IGL02220:Samsn1 APN 16 75883875 critical splice donor site probably null
R0455:Samsn1 UTSW 16 75945225 unclassified noncoding transcript
R1136:Samsn1 UTSW 16 75873520 missense probably null 0.00
R1140:Samsn1 UTSW 16 75888742 missense possibly damaging 0.73
R1180:Samsn1 UTSW 16 75873648 missense probably damaging 1.00
R1772:Samsn1 UTSW 16 75870775 missense probably benign 0.01
R1968:Samsn1 UTSW 16 75945573 exon noncoding transcript
R4035:Samsn1 UTSW 16 75909185 start codon destroyed probably null 0.99
R4372:Samsn1 UTSW 16 75859456 missense possibly damaging 0.80
R4725:Samsn1 UTSW 16 75945329 unclassified noncoding transcript
R4779:Samsn1 UTSW 16 75947289 exon noncoding transcript
R4795:Samsn1 UTSW 16 75883845 intron probably benign
R4899:Samsn1 UTSW 16 75879103 missense probably damaging 1.00
R4905:Samsn1 UTSW 16 75876465 missense possibly damaging 0.94
R5050:Samsn1 UTSW 16 75888757 missense probably benign
R5789:Samsn1 UTSW 16 75876448 missense probably damaging 1.00
R6005:Samsn1 UTSW 16 75873514 missense probably benign 0.03
R6190:Samsn1 UTSW 16 75870915 missense probably damaging 1.00
R6218:Samsn1 UTSW 16 75945274 unclassified noncoding transcript
R6630:Samsn1 UTSW 16 75879204 missense probably benign 0.00
R7086:Samsn1 UTSW 16 75870906 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGTACTAGGCCCTAAATATTGTC -3'
(R):5'- GCACGGTCTTAACCACTATTACAC -3'

Sequencing Primer
(F):5'- GGCCCTAAATATTGTCCATCTATTTC -3'
(R):5'- CGGTCTTAACCACTATTACACAAATC -3'
Posted On2020-07-28