Incidental Mutation 'R8290:Nbea'
ID 638621
Institutional Source Beutler Lab
Gene Symbol Nbea
Ensembl Gene ENSMUSG00000027799
Gene Name neurobeachin
Synonyms
MMRRC Submission 067712-MU
Accession Numbers

Genbank: NM_030595
Essential gene? Essential (E-score: 1.000) question?
Stock # R8290 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 55625195-56183701 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 56058635 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 469 (Q469*)
Ref Sequence ENSEMBL: ENSMUSP00000029374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029374]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000029374
AA Change: Q469*
SMART Domains Protein: ENSMUSP00000029374
Gene: ENSMUSG00000027799
AA Change: Q469*

DomainStartEndE-ValueType
low complexity region 19 40 N/A INTRINSIC
Pfam:Laminin_G_3 228 393 2.8e-13 PFAM
Pfam:DUF4704 462 733 4e-113 PFAM
low complexity region 792 802 N/A INTRINSIC
low complexity region 964 969 N/A INTRINSIC
low complexity region 1781 1790 N/A INTRINSIC
low complexity region 1791 1807 N/A INTRINSIC
low complexity region 1835 1845 N/A INTRINSIC
Pfam:DUF1088 1956 2122 3.5e-91 PFAM
Pfam:PH_BEACH 2148 2245 2.6e-32 PFAM
Beach 2276 2553 1.3e-205 SMART
WD40 2659 2696 2.12e2 SMART
WD40 2699 2742 2.22e0 SMART
WD40 2759 2798 9.21e0 SMART
WD40 2842 2880 2.88e-1 SMART
WD40 2883 2922 8.91e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a large, diverse group of A-kinase anchor proteins that target the activity of protein kinase A to specific subcellular sites by binding to its type II regulatory subunits. Brain-specific expression and coat protein-like membrane recruitment of a highly similar protein in mouse suggest an involvement in neuronal post-Golgi membrane traffic. Mutations in this gene may be associated with a form of autism. This gene and its expression are frequently disrupted in patients with multiple myeloma. Alternative splicing results in multiple transcript variants encoding distinct isoforms. Additional transcript variants may exist, but their full-length nature has not been determined.[provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele or transgene insertion die shortly after birth, are cyanotic, and exhibit no response to tactile stimuli, no spontaneous movement, and impaired CNS synaptic transmission. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Gene trapped(3) Transgenic(1)
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 A T 8: 86,512,282 Y1100N probably damaging Het
Abcf2 CAT CATAAT 5: 24,576,591 probably benign Het
Adgrv1 T C 13: 81,481,883 T3576A probably benign Het
Adnp2 A T 18: 80,142,733 N8K probably damaging Het
Aftph A T 11: 20,725,712 H632Q probably benign Het
Arhgef11 A T 3: 87,725,968 I710F probably damaging Het
Atp6v1c2 T C 12: 17,288,152 N341S possibly damaging Het
Ccsap T G 8: 123,859,247 D55A probably benign Het
Cdh17 A G 4: 11,817,037 N816S probably benign Het
Celf3 A G 3: 94,479,182 I26V probably benign Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Chek2 A G 5: 110,860,900 E299G possibly damaging Het
Clca2 A G 3: 145,087,958 V312A possibly damaging Het
Cnn1 A G 9: 22,101,151 K25R probably benign Het
Cry1 A T 10: 85,143,113 Y516* probably null Het
Dcaf4 T C 12: 83,541,559 S498P probably benign Het
Dmgdh T C 13: 93,706,736 V360A probably benign Het
Dnajc18 G A 18: 35,683,271 R205* probably null Het
Eif4a2 G T 16: 23,108,622 G22C probably damaging Het
Elmo2 A G 2: 165,309,003 I196T probably damaging Het
Epha3 A G 16: 63,652,496 I342T possibly damaging Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Etf1 G A 18: 34,931,838 P35L unknown Het
Etnk2 A C 1: 133,379,389 *386C probably null Het
Fgg A T 3: 83,012,834 I307F probably benign Het
Flg2 A G 3: 93,202,762 Q699R unknown Het
Foxp4 T A 17: 47,880,853 T120S unknown Het
Fzd1 A G 5: 4,757,060 V174A possibly damaging Het
Gad1 A C 2: 70,574,266 I167L probably benign Het
Gfm2 T A 13: 97,145,663 D55E probably benign Het
Gm6904 T C 14: 59,247,969 Y114C probably damaging Het
Grb14 G T 2: 64,975,585 A12E probably benign Het
Hnmt A C 2: 24,003,884 Y199* probably null Het
Kit A G 5: 75,641,169 I615V probably benign Het
Kpna6 A G 4: 129,661,304 probably null Het
Lpxn C T 19: 12,832,688 R275C probably damaging Het
Magi1 C T 6: 94,283,085 G80S probably damaging Het
Men1 A G 19: 6,338,286 I312V probably benign Het
Msx2 A G 13: 53,468,492 F161L probably damaging Het
Mtr T C 13: 12,190,253 D1107G probably damaging Het
Muc4 A T 16: 32,754,316 M1397L probably benign Het
Mybpc3 A G 2: 91,121,128 N259S probably benign Het
Myo5c A G 9: 75,288,896 K1242R probably benign Het
Myoc T C 1: 162,649,032 V435A possibly damaging Het
Ndufa10 A C 1: 92,463,147 M227R possibly damaging Het
Obscn C T 11: 59,062,710 D3831N probably damaging Het
Obscn T C 11: 59,124,574 E1024G probably damaging Het
Oma1 T C 4: 103,319,474 L145P probably damaging Het
Phf12 C A 11: 78,029,639 N1000K probably benign Het
Plxnb1 G T 9: 109,109,619 A1350S probably benign Het
Prkd1 C T 12: 50,342,016 V915I probably damaging Het
Prkra T A 2: 76,633,638 N227Y probably damaging Het
Prtg A T 9: 72,890,795 H681L probably damaging Het
Rtn1 T C 12: 72,308,419 K251R probably benign Het
Sema6b A T 17: 56,124,803 V620E possibly damaging Het
Senp7 T A 16: 56,153,637 L407* probably null Het
Sh3pxd2a A T 19: 47,314,136 L168Q probably damaging Het
Shtn1 A G 19: 58,999,894 L453P probably damaging Het
Slc26a6 G A 9: 108,856,031 R43H probably benign Het
Stac3 T C 10: 127,503,360 probably null Het
Taf2 A G 15: 55,063,020 F178S probably damaging Het
Tcp10a G A 17: 7,334,317 E239K probably benign Het
Ubox5 A G 2: 130,600,413 V118A probably damaging Het
Unc13d C A 11: 116,068,147 L729F probably damaging Het
Vmn1r228 T C 17: 20,776,462 T265A probably benign Het
Vmn2r100 G A 17: 19,531,350 V615I probably damaging Het
Vmn2r60 T G 7: 42,142,266 C538G probably damaging Het
Vmn2r93 A T 17: 18,304,029 N95I probably damaging Het
Vsig2 A G 9: 37,539,968 N55S probably benign Het
Zfp472 A G 17: 32,978,114 T388A probably benign Het
Zfp853 G A 5: 143,289,071 Q214* probably null Het
Zfp949 A G 9: 88,569,240 R288G probably damaging Het
Other mutations in Nbea
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Nbea APN 3 55628493 missense probably damaging 1.00
IGL00541:Nbea APN 3 55968089 missense probably benign 0.02
IGL00584:Nbea APN 3 56082448 missense probably damaging 0.98
IGL00648:Nbea APN 3 56009260 missense probably damaging 0.98
IGL00785:Nbea APN 3 55955393 missense probably benign
IGL00899:Nbea APN 3 55642845 missense probably benign 0.32
IGL00955:Nbea APN 3 56005472 missense possibly damaging 0.45
IGL01296:Nbea APN 3 56031536 missense probably benign 0.04
IGL01299:Nbea APN 3 55690894 missense probably damaging 1.00
IGL01393:Nbea APN 3 56005308 missense probably benign 0.02
IGL01550:Nbea APN 3 55805248 missense possibly damaging 0.93
IGL02023:Nbea APN 3 55681016 missense probably damaging 1.00
IGL02034:Nbea APN 3 55968156 missense probably damaging 1.00
IGL02061:Nbea APN 3 55717887 missense possibly damaging 0.54
IGL02082:Nbea APN 3 55968167 missense possibly damaging 0.88
IGL02113:Nbea APN 3 55992492 missense probably benign
IGL02188:Nbea APN 3 55983837 missense probably benign 0.00
IGL02319:Nbea APN 3 55985738 missense probably damaging 1.00
IGL02406:Nbea APN 3 56086266 missense probably benign 0.02
IGL02494:Nbea APN 3 55805351 missense probably benign 0.02
IGL02550:Nbea APN 3 56019414 missense probably damaging 0.98
IGL02706:Nbea APN 3 56037278 missense probably damaging 1.00
IGL02718:Nbea APN 3 55632062 nonsense probably null
IGL02822:Nbea APN 3 56019447 missense possibly damaging 0.93
IGL02885:Nbea APN 3 55631986 missense probably benign 0.01
IGL03000:Nbea APN 3 56004627 missense possibly damaging 0.94
IGL03081:Nbea APN 3 56079918 missense probably damaging 1.00
IGL03091:Nbea APN 3 56085304 missense probably damaging 1.00
IGL03368:Nbea APN 3 56079930 missense probably damaging 0.98
Neches UTSW 3 55953034 critical splice donor site probably null
scotland UTSW 3 55626908 missense probably damaging 1.00
Wales UTSW 3 56091119 missense probably damaging 1.00
FR4340:Nbea UTSW 3 56009212 critical splice donor site probably benign
G4846:Nbea UTSW 3 56087497 missense probably damaging 0.98
IGL02835:Nbea UTSW 3 55717869 missense possibly damaging 0.88
LCD18:Nbea UTSW 3 55701527 intron probably benign
R0087:Nbea UTSW 3 56091023 missense possibly damaging 0.92
R0220:Nbea UTSW 3 56005303 missense probably benign 0.30
R0324:Nbea UTSW 3 56057948 critical splice donor site probably null
R0330:Nbea UTSW 3 55642817 missense probably benign 0.27
R0391:Nbea UTSW 3 56037277 missense probably damaging 1.00
R0394:Nbea UTSW 3 56029907 missense probably damaging 1.00
R0419:Nbea UTSW 3 55819294 missense probably benign 0.05
R0503:Nbea UTSW 3 55642836 missense possibly damaging 0.79
R0521:Nbea UTSW 3 56008268 missense probably damaging 1.00
R0595:Nbea UTSW 3 55628496 missense probably benign 0.18
R0894:Nbea UTSW 3 56009340 missense possibly damaging 0.89
R1072:Nbea UTSW 3 56086196 missense possibly damaging 0.94
R1125:Nbea UTSW 3 55857006 nonsense probably null
R1169:Nbea UTSW 3 55968323 missense probably benign 0.00
R1241:Nbea UTSW 3 56058040 missense probably damaging 1.00
R1269:Nbea UTSW 3 56004781 missense probably benign 0.05
R1406:Nbea UTSW 3 56037281 missense probably benign 0.00
R1406:Nbea UTSW 3 56037281 missense probably benign 0.00
R1457:Nbea UTSW 3 56085327 missense probably damaging 1.00
R1482:Nbea UTSW 3 56079993 missense probably damaging 1.00
R1483:Nbea UTSW 3 56002790 missense probably benign 0.25
R1502:Nbea UTSW 3 56004889 missense probably benign 0.03
R1544:Nbea UTSW 3 56058827 missense probably damaging 0.99
R1629:Nbea UTSW 3 56002891 missense possibly damaging 0.52
R1647:Nbea UTSW 3 55630229 missense probably damaging 0.97
R1663:Nbea UTSW 3 55645986 missense possibly damaging 0.95
R1722:Nbea UTSW 3 55665695 missense probably damaging 1.00
R1757:Nbea UTSW 3 55630189 missense possibly damaging 0.83
R1771:Nbea UTSW 3 55934519 missense probably benign 0.00
R1796:Nbea UTSW 3 55643708 missense possibly damaging 0.48
R1844:Nbea UTSW 3 56082436 missense probably damaging 0.97
R1872:Nbea UTSW 3 55642889 missense probably benign 0.12
R1938:Nbea UTSW 3 56085322 missense probably damaging 1.00
R1940:Nbea UTSW 3 55953100 missense possibly damaging 0.78
R2062:Nbea UTSW 3 56086157 splice site probably benign
R2066:Nbea UTSW 3 55968146 missense probably damaging 1.00
R2097:Nbea UTSW 3 55723217 missense probably damaging 0.96
R2181:Nbea UTSW 3 56029939 missense possibly damaging 0.92
R2274:Nbea UTSW 3 55988085 splice site probably null
R2345:Nbea UTSW 3 56085279 missense probably damaging 1.00
R2423:Nbea UTSW 3 56085306 missense probably damaging 1.00
R2434:Nbea UTSW 3 55647460 missense possibly damaging 0.91
R2880:Nbea UTSW 3 55647358 missense probably benign 0.04
R2881:Nbea UTSW 3 55647358 missense probably benign 0.04
R2940:Nbea UTSW 3 55934624 missense probably benign 0.24
R3500:Nbea UTSW 3 55681010 missense possibly damaging 0.88
R3765:Nbea UTSW 3 56005549 missense probably damaging 1.00
R3790:Nbea UTSW 3 56005029 missense probably benign
R3808:Nbea UTSW 3 55717848 missense probably benign 0.02
R3845:Nbea UTSW 3 56086292 splice site probably benign
R4182:Nbea UTSW 3 56008427 missense probably damaging 0.99
R4385:Nbea UTSW 3 56000638 missense possibly damaging 0.77
R4419:Nbea UTSW 3 56009600 missense probably damaging 1.00
R4426:Nbea UTSW 3 56082379 missense probably damaging 0.98
R4451:Nbea UTSW 3 55992332 critical splice donor site probably null
R4456:Nbea UTSW 3 55643784 missense probably benign 0.00
R4604:Nbea UTSW 3 55723648 missense probably benign 0.18
R4687:Nbea UTSW 3 56058065 missense probably damaging 1.00
R4758:Nbea UTSW 3 56005403 missense probably benign
R4840:Nbea UTSW 3 55710670 missense probably benign 0.37
R4888:Nbea UTSW 3 56005355 missense possibly damaging 0.61
R4954:Nbea UTSW 3 56035958 missense probably damaging 1.00
R4972:Nbea UTSW 3 56085246 missense probably damaging 0.99
R4980:Nbea UTSW 3 55647351 splice site probably null
R4980:Nbea UTSW 3 55953045 missense probably benign 0.00
R5104:Nbea UTSW 3 56079927 missense probably damaging 1.00
R5139:Nbea UTSW 3 55626963 missense possibly damaging 0.90
R5166:Nbea UTSW 3 56019453 missense probably damaging 1.00
R5347:Nbea UTSW 3 56040876 missense probably damaging 1.00
R5350:Nbea UTSW 3 56019424 missense probably damaging 1.00
R5418:Nbea UTSW 3 55645989 missense possibly damaging 0.86
R5586:Nbea UTSW 3 55631971 missense probably benign 0.08
R5627:Nbea UTSW 3 55992345 missense probably damaging 1.00
R5683:Nbea UTSW 3 55628586 missense possibly damaging 0.53
R5765:Nbea UTSW 3 56005298 missense probably benign 0.15
R5853:Nbea UTSW 3 55992401 missense probably damaging 1.00
R5858:Nbea UTSW 3 55953034 critical splice donor site probably null
R5955:Nbea UTSW 3 55680983 missense probably benign 0.00
R5976:Nbea UTSW 3 55853847 missense probably benign 0.30
R6039:Nbea UTSW 3 56005117 missense probably benign 0.00
R6039:Nbea UTSW 3 56005117 missense probably benign 0.00
R6043:Nbea UTSW 3 55786475 missense probably benign 0.32
R6122:Nbea UTSW 3 56029896 missense probably damaging 1.00
R6218:Nbea UTSW 3 55628484 missense probably damaging 0.97
R6331:Nbea UTSW 3 56000616 missense possibly damaging 0.94
R6334:Nbea UTSW 3 56037149 missense probably damaging 1.00
R6393:Nbea UTSW 3 56091119 missense probably damaging 1.00
R6411:Nbea UTSW 3 55805357 missense probably benign 0.01
R6457:Nbea UTSW 3 56000569 missense probably damaging 1.00
R6476:Nbea UTSW 3 56004806 missense probably benign 0.00
R6488:Nbea UTSW 3 55717843 missense probably damaging 0.99
R6700:Nbea UTSW 3 56082448 missense possibly damaging 0.89
R6702:Nbea UTSW 3 56005502 missense probably benign 0.06
R6752:Nbea UTSW 3 55968309 missense probably benign 0.02
R6752:Nbea UTSW 3 56037219 missense probably benign
R6804:Nbea UTSW 3 56087453 missense probably benign 0.37
R6901:Nbea UTSW 3 56019415 missense probably damaging 1.00
R6933:Nbea UTSW 3 55723610 missense possibly damaging 0.63
R7124:Nbea UTSW 3 55992444 missense probably damaging 1.00
R7211:Nbea UTSW 3 56004901 missense probably benign 0.05
R7308:Nbea UTSW 3 56091031 missense probably damaging 1.00
R7405:Nbea UTSW 3 55805266 missense possibly damaging 0.94
R7669:Nbea UTSW 3 55717779 missense probably damaging 1.00
R7762:Nbea UTSW 3 55649705 missense probably damaging 1.00
R7833:Nbea UTSW 3 56002797 missense probably damaging 1.00
R7885:Nbea UTSW 3 55665689 missense probably damaging 0.97
R7935:Nbea UTSW 3 56058665 missense probably damaging 1.00
R8050:Nbea UTSW 3 55987981 missense probably damaging 0.99
R8108:Nbea UTSW 3 55819315 missense probably benign 0.11
R8314:Nbea UTSW 3 56009251 missense probably damaging 0.99
R8321:Nbea UTSW 3 56183097 missense possibly damaging 0.86
R8376:Nbea UTSW 3 55643655 missense possibly damaging 0.79
R8410:Nbea UTSW 3 56037263 missense probably damaging 1.00
R8556:Nbea UTSW 3 55647386 missense probably benign 0.25
R8753:Nbea UTSW 3 55626908 missense probably damaging 1.00
R8844:Nbea UTSW 3 56090994 missense probably damaging 0.97
R8884:Nbea UTSW 3 55805299 missense probably benign 0.00
R8886:Nbea UTSW 3 56058727 missense probably damaging 1.00
R8890:Nbea UTSW 3 56019363 splice site probably benign
R9004:Nbea UTSW 3 56002938 missense probably benign 0.01
R9022:Nbea UTSW 3 55643689 missense possibly damaging 0.79
R9080:Nbea UTSW 3 56005095 nonsense probably null
R9087:Nbea UTSW 3 55642736 critical splice donor site probably null
R9104:Nbea UTSW 3 55955388 missense probably benign
R9165:Nbea UTSW 3 56004868 missense probably benign 0.15
R9219:Nbea UTSW 3 56090972 frame shift probably null
R9221:Nbea UTSW 3 56090972 frame shift probably null
R9222:Nbea UTSW 3 56090972 frame shift probably null
R9260:Nbea UTSW 3 55983812 missense possibly damaging 0.50
R9263:Nbea UTSW 3 56090972 frame shift probably null
R9265:Nbea UTSW 3 56090972 frame shift probably null
R9294:Nbea UTSW 3 56091092 missense probably benign 0.00
R9360:Nbea UTSW 3 56035898 missense possibly damaging 0.96
R9387:Nbea UTSW 3 55991039 missense probably benign 0.12
R9428:Nbea UTSW 3 56090972 frame shift probably null
R9435:Nbea UTSW 3 56035888 missense possibly damaging 0.63
R9507:Nbea UTSW 3 55665590 missense probably damaging 1.00
R9514:Nbea UTSW 3 56029945 missense probably damaging 1.00
R9516:Nbea UTSW 3 56029945 missense probably damaging 1.00
R9674:Nbea UTSW 3 56058762 missense probably damaging 1.00
R9688:Nbea UTSW 3 55649744 missense probably benign 0.42
R9709:Nbea UTSW 3 55786458 nonsense probably null
RF051:Nbea UTSW 3 56009212 critical splice donor site probably benign
X0018:Nbea UTSW 3 56036048 missense probably benign 0.39
Z1088:Nbea UTSW 3 55723163 missense probably benign 0.34
Z1177:Nbea UTSW 3 56031550 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTAGTAACATCATGTTCAGGAAGTC -3'
(R):5'- TCTGAGAGTGATATTCATTTGGCAG -3'

Sequencing Primer
(F):5'- TCATGTTCAGGAAGTCAACAGAC -3'
(R):5'- TTTGGCAGAACATCACAAACAGGTTC -3'
Posted On 2020-07-28