Incidental Mutation 'R8290:Celf3'
ID638625
Institutional Source Beutler Lab
Gene Symbol Celf3
Ensembl Gene ENSMUSG00000028137
Gene NameCUGBP, Elav-like family member 3
SynonymsBRUNOL1, CAGH4, 4930415M08Rik, Tnrc4, ERDA4
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R8290 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location94478295-94492198 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94479182 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 26 (I26V)
Ref Sequence ENSEMBL: ENSMUSP00000143344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029784] [ENSMUST00000197558] [ENSMUST00000198316] [ENSMUST00000199775] [ENSMUST00000199884] [ENSMUST00000200342]
Predicted Effect probably damaging
Transcript: ENSMUST00000029784
AA Change: I26V

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029784
Gene: ENSMUSG00000028137
AA Change: I26V

DomainStartEndE-ValueType
RRM 8 84 4.32e-19 SMART
RRM 95 170 2.02e-19 SMART
low complexity region 208 220 N/A INTRINSIC
low complexity region 248 275 N/A INTRINSIC
low complexity region 339 373 N/A INTRINSIC
RRM 381 454 8.83e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197558
SMART Domains Protein: ENSMUSP00000143733
Gene: ENSMUSG00000028137

DomainStartEndE-ValueType
RRM 19 94 8.9e-22 SMART
low complexity region 132 144 N/A INTRINSIC
low complexity region 172 199 N/A INTRINSIC
RRM 286 359 3.7e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198316
SMART Domains Protein: ENSMUSP00000142412
Gene: ENSMUSG00000028137

DomainStartEndE-ValueType
RRM 19 94 8.7e-22 SMART
low complexity region 132 144 N/A INTRINSIC
low complexity region 172 199 N/A INTRINSIC
low complexity region 263 297 N/A INTRINSIC
RRM 305 378 3.6e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000199775
AA Change: I26V

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143532
Gene: ENSMUSG00000028137
AA Change: I26V

DomainStartEndE-ValueType
RRM 8 84 1.9e-21 SMART
RRM 96 171 8.9e-22 SMART
low complexity region 209 221 N/A INTRINSIC
low complexity region 290 324 N/A INTRINSIC
RRM 332 405 3.7e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199884
Predicted Effect probably benign
Transcript: ENSMUST00000200342
AA Change: I26V

PolyPhen 2 Score 0.437 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000143344
Gene: ENSMUSG00000028137
AA Change: I26V

DomainStartEndE-ValueType
RRM 8 84 4.32e-19 SMART
RRM 96 171 2.02e-19 SMART
low complexity region 209 221 N/A INTRINSIC
low complexity region 249 276 N/A INTRINSIC
low complexity region 368 402 N/A INTRINSIC
RRM 410 483 8.83e-25 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the CELF/BRUNOL protein family contain two N-terminal RNA recognition motif (RRM) domains, one C-terminal RRM domain, and a divergent segment of 160-230 aa between the second and third RRM domains. Members of this protein family regulate pre-mRNA alternative splicing and may also be involved in mRNA editing, and translation. Multiple alternatively spliced transcript variants encoding different isoforms have been identified in this gene. [provided by RefSeq, Feb 2010]
PHENOTYPE: Male mice homozygous for a null mutation display reduced sperm counts and motility but are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 A T 8: 86,512,282 Y1100N probably damaging Het
Abcf2 CAT CATAAT 5: 24,576,591 probably benign Het
Adgrv1 T C 13: 81,481,883 T3576A probably benign Het
Adnp2 A T 18: 80,142,733 N8K probably damaging Het
Aftph A T 11: 20,725,712 H632Q probably benign Het
Arhgef11 A T 3: 87,725,968 I710F probably damaging Het
Atp6v1c2 T C 12: 17,288,152 N341S possibly damaging Het
Ccsap T G 8: 123,859,247 D55A probably benign Het
Cdh17 A G 4: 11,817,037 N816S probably benign Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Chek2 A G 5: 110,860,900 E299G possibly damaging Het
Clca2 A G 3: 145,087,958 V312A possibly damaging Het
Cnn1 A G 9: 22,101,151 K25R probably benign Het
Cry1 A T 10: 85,143,113 Y516* probably null Het
Dcaf4 T C 12: 83,541,559 S498P probably benign Het
Dmgdh T C 13: 93,706,736 V360A probably benign Het
Dnajc18 G A 18: 35,683,271 R205* probably null Het
Eif4a2 G T 16: 23,108,622 G22C probably damaging Het
Elmo2 A G 2: 165,309,003 I196T probably damaging Het
Epha3 A G 16: 63,652,496 I342T possibly damaging Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Etf1 G A 18: 34,931,838 P35L unknown Het
Etnk2 A C 1: 133,379,389 *386C probably null Het
Fgg A T 3: 83,012,834 I307F probably benign Het
Flg2 A G 3: 93,202,762 Q699R unknown Het
Foxp4 T A 17: 47,880,853 T120S unknown Het
Fzd1 A G 5: 4,757,060 V174A possibly damaging Het
Gad1 A C 2: 70,574,266 I167L probably benign Het
Gfm2 T A 13: 97,145,663 D55E probably benign Het
Gm6904 T C 14: 59,247,969 Y114C probably damaging Het
Grb14 G T 2: 64,975,585 A12E probably benign Het
Hnmt A C 2: 24,003,884 Y199* probably null Het
Kit A G 5: 75,641,169 I615V probably benign Het
Kpna6 A G 4: 129,661,304 probably null Het
Lpxn C T 19: 12,832,688 R275C probably damaging Het
Magi1 C T 6: 94,283,085 G80S probably damaging Het
Men1 A G 19: 6,338,286 I312V probably benign Het
Msx2 A G 13: 53,468,492 F161L probably damaging Het
Mtr T C 13: 12,190,253 D1107G probably damaging Het
Muc4 A T 16: 32,754,316 M1397L probably benign Het
Mybpc3 A G 2: 91,121,128 N259S probably benign Het
Myo5c A G 9: 75,288,896 K1242R probably benign Het
Myoc T C 1: 162,649,032 V435A possibly damaging Het
Nbea G A 3: 56,058,635 Q469* probably null Het
Ndufa10 A C 1: 92,463,147 M227R possibly damaging Het
Obscn C T 11: 59,062,710 D3831N probably damaging Het
Obscn T C 11: 59,124,574 E1024G probably damaging Het
Oma1 T C 4: 103,319,474 L145P probably damaging Het
Phf12 C A 11: 78,029,639 N1000K probably benign Het
Plxnb1 G T 9: 109,109,619 A1350S probably benign Het
Prkd1 C T 12: 50,342,016 V915I probably damaging Het
Prkra T A 2: 76,633,638 N227Y probably damaging Het
Prtg A T 9: 72,890,795 H681L probably damaging Het
Rtn1 T C 12: 72,308,419 K251R probably benign Het
Sema6b A T 17: 56,124,803 V620E possibly damaging Het
Senp7 T A 16: 56,153,637 L407* probably null Het
Sh3pxd2a A T 19: 47,314,136 L168Q probably damaging Het
Shtn1 A G 19: 58,999,894 L453P probably damaging Het
Slc26a6 G A 9: 108,856,031 R43H probably benign Het
Stac3 T C 10: 127,503,360 probably null Het
Taf2 A G 15: 55,063,020 F178S probably damaging Het
Tcp10a G A 17: 7,334,317 E239K probably benign Het
Ubox5 A G 2: 130,600,413 V118A probably damaging Het
Unc13d C A 11: 116,068,147 L729F probably damaging Het
Vmn1r228 T C 17: 20,776,462 T265A probably benign Het
Vmn2r100 G A 17: 19,531,350 V615I probably damaging Het
Vmn2r60 T G 7: 42,142,266 C538G probably damaging Het
Vmn2r93 A T 17: 18,304,029 N95I probably damaging Het
Vsig2 A G 9: 37,539,968 N55S probably benign Het
Zfp472 A G 17: 32,978,114 T388A probably benign Het
Zfp853 G A 5: 143,289,071 Q214* probably null Het
Zfp949 A G 9: 88,569,240 R288G probably damaging Het
Other mutations in Celf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01348:Celf3 APN 3 94488228 missense possibly damaging 0.70
IGL02103:Celf3 APN 3 94486801 missense probably damaging 1.00
IGL03007:Celf3 APN 3 94487137 missense probably benign 0.00
R0180:Celf3 UTSW 3 94485340 missense probably damaging 1.00
R0670:Celf3 UTSW 3 94488230 small deletion probably benign
R1965:Celf3 UTSW 3 94485327 missense probably damaging 1.00
R2232:Celf3 UTSW 3 94480259 splice site probably null
R2566:Celf3 UTSW 3 94488230 small deletion probably benign
R3546:Celf3 UTSW 3 94488538 missense probably damaging 1.00
R3547:Celf3 UTSW 3 94488538 missense probably damaging 1.00
R3548:Celf3 UTSW 3 94488538 missense probably damaging 1.00
R4015:Celf3 UTSW 3 94487198 missense probably benign 0.02
R4471:Celf3 UTSW 3 94488278 splice site probably null
R4698:Celf3 UTSW 3 94484867 critical splice donor site probably null
R4816:Celf3 UTSW 3 94479222 missense probably damaging 1.00
R4939:Celf3 UTSW 3 94488230 small deletion probably benign
R5851:Celf3 UTSW 3 94479126 missense probably damaging 1.00
R6277:Celf3 UTSW 3 94485365 missense probably damaging 1.00
R6400:Celf3 UTSW 3 94480286 missense probably damaging 1.00
R6986:Celf3 UTSW 3 94487717 missense possibly damaging 0.83
R7357:Celf3 UTSW 3 94480330 missense probably damaging 0.99
R7556:Celf3 UTSW 3 94480283 missense probably damaging 1.00
R8141:Celf3 UTSW 3 94488543 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGTGTGAAGAGCCCTCCTC -3'
(R):5'- TCCAAATCAGCCCTTTCCAG -3'

Sequencing Primer
(F):5'- AAAAGCTGGCCCTGCTG -3'
(R):5'- AATCAGCCCTTTCCAGCCACTC -3'
Posted On2020-07-28