Incidental Mutation 'R0708:Frs2'
ID63863
Institutional Source Beutler Lab
Gene Symbol Frs2
Ensembl Gene ENSMUSG00000020170
Gene Namefibroblast growth factor receptor substrate 2
SynonymsSNT1, Frs2alpha, C330018A15Rik
MMRRC Submission 038891-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0708 (G1)
Quality Score99
Status Not validated
Chromosome10
Chromosomal Location117069427-117148534 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 117074092 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 455 (T455M)
Ref Sequence ENSEMBL: ENSMUSP00000020381 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020381]
Predicted Effect probably damaging
Transcript: ENSMUST00000020381
AA Change: T455M

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000020381
Gene: ENSMUSG00000020170
AA Change: T455M

DomainStartEndE-ValueType
IRS 17 110 2.04e-34 SMART
PTBI 18 110 5.71e-35 SMART
low complexity region 130 139 N/A INTRINSIC
low complexity region 450 468 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice exhibit embryonic lethality between E5.75 and E8 and defects in primitive streak formation and anterior-posterior axis formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brdt A T 5: 107,358,900 K450* probably null Het
Cand2 G A 6: 115,803,805 E1217K probably damaging Het
Col9a1 A T 1: 24,237,261 Q750L possibly damaging Het
Dnah6 A T 6: 73,212,622 S14R probably benign Het
Enox1 A G 14: 77,592,912 N319S probably benign Het
Glra3 C T 8: 56,125,364 probably benign Het
Gmppa T C 1: 75,442,574 F375S probably damaging Het
Hectd4 G A 5: 121,286,463 probably null Het
Hgf C A 5: 16,566,763 C129* probably null Het
Insc T A 7: 114,845,146 V456E probably damaging Het
Ints14 G A 9: 64,983,984 V416I probably benign Het
Klk1b11 T C 7: 43,997,728 F29L possibly damaging Het
Ogfod1 C T 8: 94,039,045 L79F possibly damaging Het
Olfr926 T A 9: 38,877,275 V33E probably damaging Het
Orc3 A T 4: 34,597,368 I224N probably damaging Het
Papss2 T C 19: 32,637,216 F111L probably damaging Het
Poc1b A G 10: 99,155,130 D291G probably null Het
Prl8a8 A T 13: 27,511,545 M72K possibly damaging Het
Ptpn7 C A 1: 135,134,547 T77K probably damaging Het
Ptpro T C 6: 137,386,253 S462P probably benign Het
Rab3gap2 T A 1: 185,249,926 S392T probably damaging Het
Sema4d A G 13: 51,712,719 V245A probably benign Het
Sgcb A T 5: 73,640,882 probably null Het
Slc24a1 T A 9: 64,947,890 K578N unknown Het
Sptbn1 A T 11: 30,114,739 V1920E probably damaging Het
Tecr A T 8: 83,573,109 I101N probably damaging Het
Tectb T C 19: 55,191,552 F277L probably benign Het
Tgs1 T A 4: 3,586,152 L343H probably benign Het
Thbs4 C A 13: 92,773,186 G368W probably damaging Het
Zfp558 T C 9: 18,456,827 S222G possibly damaging Het
Other mutations in Frs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00807:Frs2 APN 10 117074886 splice site probably benign
IGL02300:Frs2 APN 10 117077591 missense possibly damaging 0.67
IGL03028:Frs2 APN 10 117073933 missense possibly damaging 0.66
R0001:Frs2 UTSW 10 117074876 missense possibly damaging 0.76
R0513:Frs2 UTSW 10 117074665 missense possibly damaging 0.86
R0735:Frs2 UTSW 10 117074582 missense probably damaging 1.00
R1296:Frs2 UTSW 10 117081074 missense probably benign 0.30
R1934:Frs2 UTSW 10 117078901 missense probably damaging 0.99
R1938:Frs2 UTSW 10 117081106 start gained probably benign
R1992:Frs2 UTSW 10 117074554 missense probably benign
R2095:Frs2 UTSW 10 117074602 missense probably benign 0.00
R3878:Frs2 UTSW 10 117078910 missense probably benign 0.01
R4732:Frs2 UTSW 10 117074093 missense probably benign 0.31
R4733:Frs2 UTSW 10 117074093 missense probably benign 0.31
R5186:Frs2 UTSW 10 117078842 missense probably damaging 1.00
R5326:Frs2 UTSW 10 117077563 missense probably benign 0.00
R5894:Frs2 UTSW 10 117081106 start gained probably benign
R6084:Frs2 UTSW 10 117076809 critical splice donor site probably null
R7468:Frs2 UTSW 10 117074102 missense possibly damaging 0.86
R7603:Frs2 UTSW 10 117074063 missense probably benign 0.03
Z1177:Frs2 UTSW 10 117074379 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGCATCTTCGCTCTGAACGC -3'
(R):5'- AGGTCGTCTGACATCTACCAGCAC -3'

Sequencing Primer
(F):5'- AGAAGGACGCAGTGCTTCC -3'
(R):5'- TTTGGGAAGCCCGCAAG -3'
Posted On2013-07-30