Incidental Mutation 'R8290:Kit'
ID638633
Institutional Source Beutler Lab
Gene Symbol Kit
Ensembl Gene ENSMUSG00000005672
Gene NameKIT proto-oncogene receptor tyrosine kinase
SynonymsSCO5, Dominant white spotting, Tr-kit, belly-spot, CD117, Gsfsow3, Gsfsco5, SOW3, SCO1, Steel Factor Receptor, c-KIT, Gsfsco1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.944) question?
Stock #R8290 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location75574916-75656722 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75641169 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 615 (I615V)
Ref Sequence ENSEMBL: ENSMUSP00000005815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005815] [ENSMUST00000144270]
PDB Structure Structure of a class III RTK signaling assembly [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000005815
AA Change: I615V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000005815
Gene: ENSMUSG00000005672
AA Change: I615V

DomainStartEndE-ValueType
low complexity region 10 18 N/A INTRINSIC
low complexity region 25 38 N/A INTRINSIC
IG 43 113 3.02e0 SMART
IG_like 122 206 1.09e2 SMART
IGc2 225 300 3.79e-4 SMART
IG 323 413 1.21e-2 SMART
IG_like 429 501 1.88e0 SMART
transmembrane domain 524 546 N/A INTRINSIC
TyrKc 592 926 2.5e-138 SMART
low complexity region 945 963 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144270
AA Change: I611V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000116465
Gene: ENSMUSG00000005672
AA Change: I611V

DomainStartEndE-ValueType
low complexity region 1 10 N/A INTRINSIC
low complexity region 22 30 N/A INTRINSIC
low complexity region 37 50 N/A INTRINSIC
IG 55 125 3.02e0 SMART
IG_like 134 218 1.09e2 SMART
IGc2 237 312 3.79e-4 SMART
IG 335 425 1.21e-2 SMART
IG_like 441 513 1.88e0 SMART
transmembrane domain 532 554 N/A INTRINSIC
TyrKc 600 934 2.5e-138 SMART
low complexity region 953 971 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: The c-Kit proto-oncogene is the cellular homolog of the transforming gene of a feline retrovirus (v-Kit). The c-kit protein includes characteristics of a protein kinase transmembrane receptor. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations at this locus affect migration of embryonic stem cell populations, resulting in mild to severe impairments in hematopoiesis, and pigmentation. Some alleles are homozygous lethal, sterile, or result in the formation of gastrointestinal tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 A T 8: 86,512,282 Y1100N probably damaging Het
Abcf2 CAT CATAAT 5: 24,576,591 probably benign Het
Adgrv1 T C 13: 81,481,883 T3576A probably benign Het
Adnp2 A T 18: 80,142,733 N8K probably damaging Het
Aftph A T 11: 20,725,712 H632Q probably benign Het
Arhgef11 A T 3: 87,725,968 I710F probably damaging Het
Atp6v1c2 T C 12: 17,288,152 N341S possibly damaging Het
Ccsap T G 8: 123,859,247 D55A probably benign Het
Cdh17 A G 4: 11,817,037 N816S probably benign Het
Celf3 A G 3: 94,479,182 I26V probably benign Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Chek2 A G 5: 110,860,900 E299G possibly damaging Het
Clca2 A G 3: 145,087,958 V312A possibly damaging Het
Cnn1 A G 9: 22,101,151 K25R probably benign Het
Cry1 A T 10: 85,143,113 Y516* probably null Het
Dcaf4 T C 12: 83,541,559 S498P probably benign Het
Dmgdh T C 13: 93,706,736 V360A probably benign Het
Dnajc18 G A 18: 35,683,271 R205* probably null Het
Eif4a2 G T 16: 23,108,622 G22C probably damaging Het
Elmo2 A G 2: 165,309,003 I196T probably damaging Het
Epha3 A G 16: 63,652,496 I342T possibly damaging Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Etf1 G A 18: 34,931,838 P35L unknown Het
Etnk2 A C 1: 133,379,389 *386C probably null Het
Fgg A T 3: 83,012,834 I307F probably benign Het
Flg2 A G 3: 93,202,762 Q699R unknown Het
Foxp4 T A 17: 47,880,853 T120S unknown Het
Fzd1 A G 5: 4,757,060 V174A possibly damaging Het
Gad1 A C 2: 70,574,266 I167L probably benign Het
Gfm2 T A 13: 97,145,663 D55E probably benign Het
Gm6904 T C 14: 59,247,969 Y114C probably damaging Het
Grb14 G T 2: 64,975,585 A12E probably benign Het
Hnmt A C 2: 24,003,884 Y199* probably null Het
Kpna6 A G 4: 129,661,304 probably null Het
Lpxn C T 19: 12,832,688 R275C probably damaging Het
Magi1 C T 6: 94,283,085 G80S probably damaging Het
Men1 A G 19: 6,338,286 I312V probably benign Het
Msx2 A G 13: 53,468,492 F161L probably damaging Het
Mtr T C 13: 12,190,253 D1107G probably damaging Het
Muc4 A T 16: 32,754,316 M1397L probably benign Het
Mybpc3 A G 2: 91,121,128 N259S probably benign Het
Myo5c A G 9: 75,288,896 K1242R probably benign Het
Myoc T C 1: 162,649,032 V435A possibly damaging Het
Nbea G A 3: 56,058,635 Q469* probably null Het
Ndufa10 A C 1: 92,463,147 M227R possibly damaging Het
Obscn C T 11: 59,062,710 D3831N probably damaging Het
Obscn T C 11: 59,124,574 E1024G probably damaging Het
Oma1 T C 4: 103,319,474 L145P probably damaging Het
Phf12 C A 11: 78,029,639 N1000K probably benign Het
Plxnb1 G T 9: 109,109,619 A1350S probably benign Het
Prkd1 C T 12: 50,342,016 V915I probably damaging Het
Prkra T A 2: 76,633,638 N227Y probably damaging Het
Prtg A T 9: 72,890,795 H681L probably damaging Het
Rtn1 T C 12: 72,308,419 K251R probably benign Het
Sema6b A T 17: 56,124,803 V620E possibly damaging Het
Senp7 T A 16: 56,153,637 L407* probably null Het
Sh3pxd2a A T 19: 47,314,136 L168Q probably damaging Het
Shtn1 A G 19: 58,999,894 L453P probably damaging Het
Slc26a6 G A 9: 108,856,031 R43H probably benign Het
Stac3 T C 10: 127,503,360 probably null Het
Taf2 A G 15: 55,063,020 F178S probably damaging Het
Tcp10a G A 17: 7,334,317 E239K probably benign Het
Ubox5 A G 2: 130,600,413 V118A probably damaging Het
Unc13d C A 11: 116,068,147 L729F probably damaging Het
Vmn1r228 T C 17: 20,776,462 T265A probably benign Het
Vmn2r100 G A 17: 19,531,350 V615I probably damaging Het
Vmn2r60 T G 7: 42,142,266 C538G probably damaging Het
Vmn2r93 A T 17: 18,304,029 N95I probably damaging Het
Vsig2 A G 9: 37,539,968 N55S probably benign Het
Zfp472 A G 17: 32,978,114 T388A probably benign Het
Zfp853 G A 5: 143,289,071 Q214* probably null Het
Zfp949 A G 9: 88,569,240 R288G probably damaging Het
Other mutations in Kit
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00466:Kit APN 5 75610819 missense probably benign 0.00
IGL00834:Kit APN 5 75645959 missense probably damaging 1.00
IGL00846:Kit APN 5 75640811 missense probably damaging 0.98
IGL01149:Kit APN 5 75610876 missense probably damaging 0.97
IGL01341:Kit APN 5 75607074 missense probably damaging 1.00
IGL02004:Kit APN 5 75621014 missense probably benign
IGL02281:Kit APN 5 75654534 missense possibly damaging 0.66
IGL02424:Kit APN 5 75639106 missense probably benign
IGL02697:Kit APN 5 75607259 missense probably benign
IGL02929:Kit APN 5 75640769 missense probably damaging 1.00
IGL03053:Kit APN 5 75610914 missense probably benign
IGL03127:Kit APN 5 75641188 missense probably benign 0.44
IGL03174:Kit APN 5 75607113 missense probably benign
IGL03381:Kit APN 5 75607128 missense probably benign 0.04
casper UTSW 5 75645875 missense probably damaging 1.00
Mooyah2 UTSW 5 75652808 missense probably damaging 1.00
pretty2 UTSW 5 75649550 missense probably damaging 1.00
slimmer UTSW 5 75640757 missense possibly damaging 0.94
IGL02837:Kit UTSW 5 75639008 missense probably benign 0.00
R0022:Kit UTSW 5 75622997 missense probably benign 0.00
R0022:Kit UTSW 5 75622997 missense probably benign 0.00
R0092:Kit UTSW 5 75647754 missense possibly damaging 0.93
R0254:Kit UTSW 5 75620921 missense probably benign
R0329:Kit UTSW 5 75652829 missense probably damaging 1.00
R0609:Kit UTSW 5 75610879 missense probably benign 0.35
R1068:Kit UTSW 5 75609518 missense probably benign
R1115:Kit UTSW 5 75649532 splice site probably benign
R1480:Kit UTSW 5 75637317 missense probably benign 0.00
R1639:Kit UTSW 5 75652807 missense probably damaging 1.00
R1801:Kit UTSW 5 75648393 missense probably damaging 1.00
R1973:Kit UTSW 5 75615442 missense probably damaging 1.00
R2033:Kit UTSW 5 75637317 missense possibly damaging 0.88
R3125:Kit UTSW 5 75647827 missense probably benign 0.07
R3125:Kit UTSW 5 75647828 missense probably null 0.00
R3437:Kit UTSW 5 75645905 missense probably damaging 1.00
R3791:Kit UTSW 5 75639150 missense probably damaging 1.00
R3939:Kit UTSW 5 75609318 missense probably benign 0.00
R3940:Kit UTSW 5 75609318 missense probably benign 0.00
R3941:Kit UTSW 5 75609318 missense probably benign 0.00
R3942:Kit UTSW 5 75609318 missense probably benign 0.00
R4092:Kit UTSW 5 75610810 missense probably benign 0.28
R4376:Kit UTSW 5 75640499 missense probably benign 0.00
R4377:Kit UTSW 5 75640499 missense probably benign 0.00
R4668:Kit UTSW 5 75641220 splice site probably null
R5104:Kit UTSW 5 75615478 missense probably benign 0.00
R5152:Kit UTSW 5 75620847 missense probably benign 0.00
R5154:Kit UTSW 5 75640540 missense probably damaging 0.99
R5508:Kit UTSW 5 75649548 missense probably damaging 1.00
R5624:Kit UTSW 5 75609394 missense probably benign 0.40
R5731:Kit UTSW 5 75654415 missense possibly damaging 0.93
R6270:Kit UTSW 5 75609509 missense probably benign
R6565:Kit UTSW 5 75645853 missense probably damaging 1.00
R6694:Kit UTSW 5 75640757 missense possibly damaging 0.94
R6805:Kit UTSW 5 75652808 missense probably damaging 1.00
R6823:Kit UTSW 5 75652649 missense probably benign 0.01
R6848:Kit UTSW 5 75607212 missense probably benign
R7021:Kit UTSW 5 75620967 missense probably benign 0.00
R7080:Kit UTSW 5 75607281 missense probably damaging 0.99
R7117:Kit UTSW 5 75607098 missense probably benign 0.18
R7156:Kit UTSW 5 75615374 missense probably benign 0.14
R7379:Kit UTSW 5 75647752 missense probably damaging 1.00
R7427:Kit UTSW 5 75645847 missense possibly damaging 0.92
R7438:Kit UTSW 5 75639000 missense probably benign 0.01
R7531:Kit UTSW 5 75607040 missense probably damaging 0.99
R7711:Kit UTSW 5 75637359 missense probably damaging 0.97
R7810:Kit UTSW 5 75609322 missense probably benign 0.11
R7819:Kit UTSW 5 75645932 missense probably benign 0.41
R8021:Kit UTSW 5 75615491 missense possibly damaging 0.79
R8139:Kit UTSW 5 75652805 missense probably damaging 0.99
R8165:Kit UTSW 5 75620880 missense possibly damaging 0.94
R8249:Kit UTSW 5 75641408 missense probably damaging 0.97
R8288:Kit UTSW 5 75654489 missense probably damaging 1.00
R8829:Kit UTSW 5 75639131 missense probably benign 0.41
R8832:Kit UTSW 5 75639131 missense probably benign 0.41
U24488:Kit UTSW 5 75623014 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAAACTGCACAGGAGTTGGC -3'
(R):5'- GCCTCTCTTTCTGTTAAATGGG -3'

Sequencing Primer
(F):5'- TTAGCAGAAAGAGCCCCGTAG -3'
(R):5'- CTGTTAAATGGGCACTTGCTAAAAGG -3'
Posted On2020-07-28