Mutagenetix > Incidental Mutation

Incidental Mutation 'R0708:Sptbn1'

63864

Institutional Source

Beutler Lab

Gene Symbol

Sptbn1

Ensembl Gene

ENSMUSG00000020315

Gene Name

spectrin beta, non-erythrocytic 1

Synonyms

beta fodrin, Spnb-2, 9930031C03Rik, spectrin G, elf1, brain spectrin, elf3, Spnb2, non-erythrocytic

MMRRC Submission

038891-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0708 (G1)

Quality Score

107

Status

Not validated

Chromosome

Chromosomal Location

30049395-30218175 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 30064739 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 1920 (V1920E)

Ref Sequence

ENSEMBL: ENSMUSP00000114841 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006629] [ENSMUST00000011877] [ENSMUST00000102838] [ENSMUST00000124231]

AlphaFold

Q62261

Predicted Effect

probably damaging
Transcript: ENSMUST00000006629
AA Change: V1920E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000006629
Gene: ENSMUSG00000020315
AA Change: V1920E

Domain	Start	End	E-Value	Type
low complexity region	20	34	N/A	INTRINSIC
CH	56	156	3.02e-28	SMART
CH	175	273	8.73e-25	SMART
SPEC	305	411	2.03e0	SMART
SPEC	425	525	6.42e-26	SMART
SPEC	531	635	4.61e-27	SMART
SPEC	641	741	2.36e-33	SMART
SPEC	747	846	1.2e-25	SMART
SPEC	852	952	7.16e-24	SMART
SPEC	958	1059	6.58e-23	SMART
SPEC	1065	1166	1.79e-24	SMART
SPEC	1172	1272	2.2e-24	SMART
SPEC	1278	1377	5.18e-21	SMART
SPEC	1383	1482	1.02e-19	SMART
SPEC	1488	1589	7.2e-29	SMART
SPEC	1595	1695	8.03e-27	SMART
SPEC	1701	1802	9.73e-26	SMART
SPEC	1808	1908	9.82e-22	SMART
SPEC	1914	2014	8.68e-23	SMART
SPEC	2020	2162	3.1e-10	SMART
PH	2197	2308	1.64e-18	SMART
low complexity region	2312	2327	N/A	INTRINSIC
low complexity region	2343	2355	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000011877
AA Change: V1920E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000011877
Gene: ENSMUSG00000020315
AA Change: V1920E

Domain	Start	End	E-Value	Type
low complexity region	20	34	N/A	INTRINSIC
CH	56	156	3.02e-28	SMART
CH	175	273	8.73e-25	SMART
SPEC	305	411	2.03e0	SMART
SPEC	425	525	6.42e-26	SMART
SPEC	531	635	4.61e-27	SMART
SPEC	641	741	2.36e-33	SMART
SPEC	747	846	1.2e-25	SMART
SPEC	852	952	7.16e-24	SMART
SPEC	958	1059	6.58e-23	SMART
SPEC	1065	1166	1.79e-24	SMART
SPEC	1172	1272	2.2e-24	SMART
SPEC	1278	1377	5.18e-21	SMART
SPEC	1383	1482	1.02e-19	SMART
SPEC	1488	1589	7.2e-29	SMART
SPEC	1595	1695	8.03e-27	SMART
SPEC	1701	1802	9.73e-26	SMART
SPEC	1808	1908	9.82e-22	SMART
SPEC	1914	2014	8.68e-23	SMART
SPEC	2020	2162	3.1e-10	SMART
PH	2197	2308	1.64e-18	SMART
low complexity region	2312	2327	N/A	INTRINSIC
low complexity region	2343	2355	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000102838
AA Change: V1907E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099902
Gene: ENSMUSG00000020315
AA Change: V1907E

Domain	Start	End	E-Value	Type
CH	43	143	3.02e-28	SMART
CH	162	260	8.73e-25	SMART
SPEC	292	398	2.03e0	SMART
SPEC	412	512	6.42e-26	SMART
SPEC	518	622	4.61e-27	SMART
SPEC	628	728	2.36e-33	SMART
SPEC	734	833	1.2e-25	SMART
SPEC	839	939	7.16e-24	SMART
SPEC	945	1046	6.58e-23	SMART
SPEC	1052	1153	1.79e-24	SMART
SPEC	1159	1259	2.2e-24	SMART
SPEC	1265	1364	5.18e-21	SMART
SPEC	1370	1469	1.02e-19	SMART
SPEC	1475	1576	7.2e-29	SMART
SPEC	1582	1682	8.03e-27	SMART
SPEC	1688	1789	9.73e-26	SMART
SPEC	1795	1895	9.82e-22	SMART
SPEC	1901	2001	8.68e-23	SMART
SPEC	2007	2114	2.66e-9	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000124231
AA Change: V1920E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000114841
Gene: ENSMUSG00000020315
AA Change: V1920E

Domain	Start	End	E-Value	Type
low complexity region	20	34	N/A	INTRINSIC
CH	56	156	3.02e-28	SMART
CH	175	273	8.73e-25	SMART
SPEC	305	411	2.03e0	SMART
SPEC	425	525	6.42e-26	SMART
SPEC	531	635	4.61e-27	SMART
SPEC	641	741	2.36e-33	SMART
SPEC	747	846	1.2e-25	SMART
SPEC	852	952	7.16e-24	SMART
SPEC	958	1059	6.58e-23	SMART
SPEC	1065	1166	1.79e-24	SMART
SPEC	1172	1272	2.2e-24	SMART
SPEC	1278	1377	5.18e-21	SMART
SPEC	1383	1482	1.02e-19	SMART
SPEC	1488	1589	7.2e-29	SMART
SPEC	1595	1695	8.03e-27	SMART
SPEC	1701	1802	9.73e-26	SMART
SPEC	1808	1908	9.82e-22	SMART
SPEC	1914	2014	8.68e-23	SMART
SPEC	2020	2092	6.42e-2	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127209

Meta Mutation Damage Score

0.9081

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.5%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is composed of two antiparallel dimers of alpha- and beta- subunits. This gene is one member of a family of beta-spectrin genes. The encoded protein contains an N-terminal actin-binding domain, and 17 spectrin repeats which are involved in dimer formation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to mid-gestational lethality due to gastrointestinal, liver, neural, and cardiac defects, whereas heterozygotes survive until adulthood and spontaneously develop cancers in several organs. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Brdt	A	T	5: 107,506,766 (GRCm39)	K450*	probably null	Het
Cand2	G	A	6: 115,780,766 (GRCm39)	E1217K	probably damaging	Het
Col9a1	A	T	1: 24,276,342 (GRCm39)	Q750L	possibly damaging	Het
Dnah6	A	T	6: 73,189,605 (GRCm39)	S14R	probably benign	Het
Enox1	A	G	14: 77,830,352 (GRCm39)	N319S	probably benign	Het
Frs2	G	A	10: 116,909,997 (GRCm39)	T455M	probably damaging	Het
Glra3	C	T	8: 56,578,399 (GRCm39)		probably benign	Het
Gmppa	T	C	1: 75,419,218 (GRCm39)	F375S	probably damaging	Het
Hectd4	G	A	5: 121,424,526 (GRCm39)		probably null	Het
Hgf	C	A	5: 16,771,761 (GRCm39)	C129*	probably null	Het
Insc	T	A	7: 114,444,381 (GRCm39)	V456E	probably damaging	Het
Ints14	G	A	9: 64,891,266 (GRCm39)	V416I	probably benign	Het
Klk1b11	T	C	7: 43,647,152 (GRCm39)	F29L	possibly damaging	Het
Ogfod1	C	T	8: 94,765,673 (GRCm39)	L79F	possibly damaging	Het
Or8d2b	T	A	9: 38,788,571 (GRCm39)	V33E	probably damaging	Het
Orc3	A	T	4: 34,597,368 (GRCm39)	I224N	probably damaging	Het
Papss2	T	C	19: 32,614,616 (GRCm39)	F111L	probably damaging	Het
Poc1b	A	G	10: 98,990,992 (GRCm39)	D291G	probably null	Het
Prl8a8	A	T	13: 27,695,528 (GRCm39)	M72K	possibly damaging	Het
Ptpn7	C	A	1: 135,062,285 (GRCm39)	T77K	probably damaging	Het
Ptpro	T	C	6: 137,363,251 (GRCm39)	S462P	probably benign	Het
Rab3gap2	T	A	1: 184,982,123 (GRCm39)	S392T	probably damaging	Het
Sema4d	A	G	13: 51,866,755 (GRCm39)	V245A	probably benign	Het
Sgcb	A	T	5: 73,798,225 (GRCm39)		probably null	Het
Slc24a1	T	A	9: 64,855,172 (GRCm39)	K578N	unknown	Het
Tecr	A	T	8: 84,299,738 (GRCm39)	I101N	probably damaging	Het
Tectb	T	C	19: 55,179,984 (GRCm39)	F277L	probably benign	Het
Tgs1	T	A	4: 3,586,152 (GRCm39)	L343H	probably benign	Het
Thbs4	C	A	13: 92,909,694 (GRCm39)	G368W	probably damaging	Het
Zfp558	T	C	9: 18,368,123 (GRCm39)	S222G	possibly damaging	Het

Other mutations in Sptbn1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00227:Sptbn1	APN	11	30,060,818 (GRCm39)	nonsense	probably null
IGL01098:Sptbn1	APN	11	30,109,385 (GRCm39)	missense	probably damaging	1.00
IGL01843:Sptbn1	APN	11	30,054,623 (GRCm39)	missense	probably benign	0.02
IGL02070:Sptbn1	APN	11	30,095,979 (GRCm39)	missense	probably damaging	0.99
IGL02075:Sptbn1	APN	11	30,088,496 (GRCm39)	missense	probably damaging	1.00
IGL02094:Sptbn1	APN	11	30,050,659 (GRCm39)	missense	probably benign	0.01
IGL02102:Sptbn1	APN	11	30,087,427 (GRCm39)	missense	probably damaging	1.00
IGL02189:Sptbn1	APN	11	30,067,871 (GRCm39)	missense	probably damaging	1.00
IGL02256:Sptbn1	APN	11	30,070,990 (GRCm39)	missense	probably benign	0.24
IGL02301:Sptbn1	APN	11	30,092,129 (GRCm39)	missense	probably damaging	1.00
IGL02354:Sptbn1	APN	11	30,060,783 (GRCm39)	missense	probably damaging	1.00
IGL02361:Sptbn1	APN	11	30,060,783 (GRCm39)	missense	probably damaging	1.00
IGL02377:Sptbn1	APN	11	30,069,491 (GRCm39)	missense	possibly damaging	0.92
IGL02504:Sptbn1	APN	11	30,092,293 (GRCm39)	missense	probably damaging	1.00
IGL02672:Sptbn1	APN	11	30,087,239 (GRCm39)	missense	probably damaging	1.00
IGL02733:Sptbn1	APN	11	30,147,747 (GRCm39)	missense	probably benign	0.12
IGL02755:Sptbn1	APN	11	30,092,247 (GRCm39)	missense	probably damaging	1.00
R0006:Sptbn1	UTSW	11	30,073,855 (GRCm39)	missense	probably damaging	1.00
R0006:Sptbn1	UTSW	11	30,073,855 (GRCm39)	missense	probably damaging	1.00
R0096:Sptbn1	UTSW	11	30,064,739 (GRCm39)	missense	probably damaging	1.00
R0139:Sptbn1	UTSW	11	30,092,289 (GRCm39)	missense	probably benign	0.00
R0370:Sptbn1	UTSW	11	30,071,545 (GRCm39)	missense	probably benign
R0389:Sptbn1	UTSW	11	30,089,250 (GRCm39)	missense	possibly damaging	0.95
R0415:Sptbn1	UTSW	11	30,099,576 (GRCm39)	missense	probably damaging	1.00
R0552:Sptbn1	UTSW	11	30,095,985 (GRCm39)	missense	possibly damaging	0.92
R0601:Sptbn1	UTSW	11	30,100,008 (GRCm39)	missense	probably damaging	1.00
R0609:Sptbn1	UTSW	11	30,088,979 (GRCm39)	missense	probably damaging	1.00
R0675:Sptbn1	UTSW	11	30,067,903 (GRCm39)	missense	probably damaging	1.00
R0711:Sptbn1	UTSW	11	30,064,739 (GRCm39)	missense	probably damaging	1.00
R0729:Sptbn1	UTSW	11	30,060,902 (GRCm39)	missense	probably damaging	0.96
R0755:Sptbn1	UTSW	11	30,089,016 (GRCm39)	missense	probably damaging	1.00
R0892:Sptbn1	UTSW	11	30,092,201 (GRCm39)	missense	probably damaging	1.00
R0927:Sptbn1	UTSW	11	30,071,591 (GRCm39)	missense	probably damaging	1.00
R1102:Sptbn1	UTSW	11	30,070,785 (GRCm39)	missense	possibly damaging	0.93
R1460:Sptbn1	UTSW	11	30,088,637 (GRCm39)	missense	possibly damaging	0.50
R1479:Sptbn1	UTSW	11	30,063,909 (GRCm39)	missense	probably damaging	1.00
R1496:Sptbn1	UTSW	11	30,071,498 (GRCm39)	missense	probably damaging	1.00
R1649:Sptbn1	UTSW	11	30,087,301 (GRCm39)	missense	probably damaging	0.97
R1663:Sptbn1	UTSW	11	30,070,783 (GRCm39)	missense	possibly damaging	0.53
R1671:Sptbn1	UTSW	11	30,092,245 (GRCm39)	missense	possibly damaging	0.57
R1680:Sptbn1	UTSW	11	30,109,371 (GRCm39)	missense	possibly damaging	0.92
R1695:Sptbn1	UTSW	11	30,086,124 (GRCm39)	missense	probably benign	0.13
R1868:Sptbn1	UTSW	11	30,064,781 (GRCm39)	missense	possibly damaging	0.70
R1918:Sptbn1	UTSW	11	30,092,414 (GRCm39)	missense	probably damaging	1.00
R1921:Sptbn1	UTSW	11	30,054,469 (GRCm39)	missense	probably damaging	0.98
R2026:Sptbn1	UTSW	11	30,054,559 (GRCm39)	missense	probably benign	0.02
R2038:Sptbn1	UTSW	11	30,109,293 (GRCm39)	critical splice donor site	probably null
R2047:Sptbn1	UTSW	11	30,088,360 (GRCm39)	splice site	probably benign
R2312:Sptbn1	UTSW	11	30,104,249 (GRCm39)	missense	probably damaging	1.00
R3430:Sptbn1	UTSW	11	30,169,686 (GRCm39)	missense	possibly damaging	0.67
R3624:Sptbn1	UTSW	11	30,090,593 (GRCm39)	missense	probably damaging	1.00
R3723:Sptbn1	UTSW	11	30,087,335 (GRCm39)	missense	possibly damaging	0.59
R3862:Sptbn1	UTSW	11	30,092,329 (GRCm39)	missense	possibly damaging	0.63
R4446:Sptbn1	UTSW	11	30,089,114 (GRCm39)	missense	possibly damaging	0.70
R4582:Sptbn1	UTSW	11	30,169,597 (GRCm39)	missense	probably damaging	1.00
R4705:Sptbn1	UTSW	11	30,050,660 (GRCm39)	missense	probably benign
R4707:Sptbn1	UTSW	11	30,087,197 (GRCm39)	missense	possibly damaging	0.61
R4718:Sptbn1	UTSW	11	30,104,297 (GRCm39)	missense	probably damaging	1.00
R4789:Sptbn1	UTSW	11	30,067,759 (GRCm39)	missense	probably benign
R4824:Sptbn1	UTSW	11	30,068,295 (GRCm39)	missense	possibly damaging	0.72
R4855:Sptbn1	UTSW	11	30,092,353 (GRCm39)	missense	probably damaging	1.00
R5009:Sptbn1	UTSW	11	30,074,016 (GRCm39)	missense	probably benign	0.05
R5071:Sptbn1	UTSW	11	30,063,854 (GRCm39)	critical splice donor site	probably null
R5153:Sptbn1	UTSW	11	30,071,510 (GRCm39)	missense	possibly damaging	0.82
R5334:Sptbn1	UTSW	11	30,087,364 (GRCm39)	missense	possibly damaging	0.92
R5462:Sptbn1	UTSW	11	30,050,520 (GRCm39)	missense	possibly damaging	0.94
R5523:Sptbn1	UTSW	11	30,087,560 (GRCm39)	missense	probably damaging	1.00
R5707:Sptbn1	UTSW	11	30,093,174 (GRCm39)	missense	possibly damaging	0.65
R5724:Sptbn1	UTSW	11	30,094,113 (GRCm39)	missense	possibly damaging	0.91
R5738:Sptbn1	UTSW	11	30,095,941 (GRCm39)	missense	probably damaging	1.00
R5864:Sptbn1	UTSW	11	30,095,925 (GRCm39)	missense	probably damaging	1.00
R5895:Sptbn1	UTSW	11	30,073,978 (GRCm39)	missense	probably damaging	0.99
R5932:Sptbn1	UTSW	11	30,086,136 (GRCm39)	missense	probably damaging	1.00
R5966:Sptbn1	UTSW	11	30,074,873 (GRCm39)	missense	probably damaging	1.00
R5984:Sptbn1	UTSW	11	30,068,464 (GRCm39)	missense	probably damaging	1.00
R6155:Sptbn1	UTSW	11	30,087,403 (GRCm39)	missense	probably damaging	0.99
R6163:Sptbn1	UTSW	11	30,109,443 (GRCm39)	nonsense	probably null
R6226:Sptbn1	UTSW	11	30,086,054 (GRCm39)	missense	probably damaging	1.00
R6271:Sptbn1	UTSW	11	30,050,660 (GRCm39)	missense	probably benign	0.00
R6443:Sptbn1	UTSW	11	30,089,429 (GRCm39)	missense	possibly damaging	0.56
R6591:Sptbn1	UTSW	11	30,063,984 (GRCm39)	missense	probably damaging	0.99
R6616:Sptbn1	UTSW	11	30,074,030 (GRCm39)	missense	probably benign	0.08
R6691:Sptbn1	UTSW	11	30,063,984 (GRCm39)	missense	probably damaging	0.99
R6751:Sptbn1	UTSW	11	30,067,859 (GRCm39)	missense	probably damaging	1.00
R6823:Sptbn1	UTSW	11	30,064,787 (GRCm39)	missense	probably damaging	1.00
R6863:Sptbn1	UTSW	11	30,096,777 (GRCm39)	missense	possibly damaging	0.94
R6885:Sptbn1	UTSW	11	30,088,634 (GRCm39)	missense	probably benign	0.26
R6892:Sptbn1	UTSW	11	30,092,187 (GRCm39)	missense	probably benign	0.27
R6998:Sptbn1	UTSW	11	30,050,633 (GRCm39)	missense	probably damaging	0.97
R7043:Sptbn1	UTSW	11	30,053,323 (GRCm39)	missense	probably benign	0.02
R7092:Sptbn1	UTSW	11	30,087,119 (GRCm39)	missense	possibly damaging	0.75
R7272:Sptbn1	UTSW	11	30,064,859 (GRCm39)	missense	possibly damaging	0.93
R7301:Sptbn1	UTSW	11	30,067,798 (GRCm39)	nonsense	probably null
R7379:Sptbn1	UTSW	11	30,089,292 (GRCm39)	missense	possibly damaging	0.72
R7774:Sptbn1	UTSW	11	30,092,142 (GRCm39)	missense	probably damaging	0.99
R7813:Sptbn1	UTSW	11	30,088,455 (GRCm39)	missense	probably damaging	1.00
R7837:Sptbn1	UTSW	11	30,088,832 (GRCm39)	missense	probably damaging	1.00
R7843:Sptbn1	UTSW	11	30,104,320 (GRCm39)	missense	probably damaging	1.00
R7846:Sptbn1	UTSW	11	30,092,153 (GRCm39)	missense	probably damaging	0.98
R7877:Sptbn1	UTSW	11	30,079,601 (GRCm39)	missense	possibly damaging	0.94
R7902:Sptbn1	UTSW	11	30,086,048 (GRCm39)	missense	probably damaging	1.00
R8060:Sptbn1	UTSW	11	30,051,616 (GRCm39)	missense	probably damaging	0.99
R8116:Sptbn1	UTSW	11	30,089,117 (GRCm39)	missense	probably damaging	1.00
R8169:Sptbn1	UTSW	11	30,147,783 (GRCm39)	missense	possibly damaging	0.62
R8208:Sptbn1	UTSW	11	30,074,972 (GRCm39)	missense	probably damaging	1.00
R8247:Sptbn1	UTSW	11	30,063,906 (GRCm39)	missense	possibly damaging	0.84
R8412:Sptbn1	UTSW	11	30,088,457 (GRCm39)	missense	probably damaging	1.00
R8470:Sptbn1	UTSW	11	30,070,758 (GRCm39)	missense	possibly damaging	0.78
R8544:Sptbn1	UTSW	11	30,169,750 (GRCm39)	start gained	probably benign
R8674:Sptbn1	UTSW	11	30,089,352 (GRCm39)	missense	possibly damaging	0.73
R8846:Sptbn1	UTSW	11	30,075,009 (GRCm39)	missense	possibly damaging	0.77
R8889:Sptbn1	UTSW	11	30,067,800 (GRCm39)	missense	probably benign	0.03
R8892:Sptbn1	UTSW	11	30,067,800 (GRCm39)	missense	probably benign	0.03
R8927:Sptbn1	UTSW	11	30,088,962 (GRCm39)	missense	probably damaging	1.00
R8928:Sptbn1	UTSW	11	30,088,962 (GRCm39)	missense	probably damaging	1.00
R8975:Sptbn1	UTSW	11	30,073,869 (GRCm39)	missense	possibly damaging	0.86
R9115:Sptbn1	UTSW	11	30,087,526 (GRCm39)	missense	probably damaging	1.00
R9127:Sptbn1	UTSW	11	30,104,356 (GRCm39)	missense	probably damaging	1.00
R9193:Sptbn1	UTSW	11	30,087,551 (GRCm39)	missense	possibly damaging	0.77
R9237:Sptbn1	UTSW	11	30,096,803 (GRCm39)	missense	probably damaging	1.00
Z1176:Sptbn1	UTSW	11	30,147,787 (GRCm39)	missense	probably benign	0.13
Z1176:Sptbn1	UTSW	11	30,087,439 (GRCm39)	missense	probably damaging	1.00
Z1177:Sptbn1	UTSW	11	30,070,659 (GRCm39)	missense	probably benign	0.27
Z1177:Sptbn1	UTSW	11	30,064,734 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACTCCAAAATGCCTGAGTGGGAAG -3'
(R):5'- TATTAAGAGGCACAGACCCGGCAAC -3'

Sequencing Primer
(F):5'- TCTAGAGGAAATGAGCACCAC -3'
(R):5'- AGTAGTGAAACCTGGCTTTTCTC -3'

Posted On

2013-07-30