Incidental Mutation 'R8290:Dmgdh'
ID638661
Institutional Source Beutler Lab
Gene Symbol Dmgdh
Ensembl Gene ENSMUSG00000042102
Gene Namedimethylglycine dehydrogenase precursor
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8290 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location93674433-93752833 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 93706736 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 360 (V360A)
Ref Sequence ENSEMBL: ENSMUSP00000039663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048001]
Predicted Effect probably benign
Transcript: ENSMUST00000048001
AA Change: V360A

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000039663
Gene: ENSMUSG00000042102
AA Change: V360A

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:DAO 44 407 9.3e-64 PFAM
Pfam:FAO_M 410 464 1e-15 PFAM
Pfam:GCV_T 468 738 3.6e-72 PFAM
Pfam:SoxG 559 697 1.3e-10 PFAM
Pfam:GCV_T_C 745 838 3.9e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an enzyme involved in the catabolism of choline, catalyzing the oxidative demethylation of dimethylglycine to form sarcosine. The enzyme is found as a monomer in the mitochondrial matrix, and uses flavin adenine dinucleotide and folate as cofactors. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 A T 8: 86,512,282 Y1100N probably damaging Het
Abcf2 CAT CATAAT 5: 24,576,591 probably benign Het
Adgrv1 T C 13: 81,481,883 T3576A probably benign Het
Adnp2 A T 18: 80,142,733 N8K probably damaging Het
Aftph A T 11: 20,725,712 H632Q probably benign Het
Arhgef11 A T 3: 87,725,968 I710F probably damaging Het
Atp6v1c2 T C 12: 17,288,152 N341S possibly damaging Het
Ccsap T G 8: 123,859,247 D55A probably benign Het
Cdh17 A G 4: 11,817,037 N816S probably benign Het
Celf3 A G 3: 94,479,182 I26V probably benign Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Chek2 A G 5: 110,860,900 E299G possibly damaging Het
Clca2 A G 3: 145,087,958 V312A possibly damaging Het
Cnn1 A G 9: 22,101,151 K25R probably benign Het
Cry1 A T 10: 85,143,113 Y516* probably null Het
Dcaf4 T C 12: 83,541,559 S498P probably benign Het
Dnajc18 G A 18: 35,683,271 R205* probably null Het
Eif4a2 G T 16: 23,108,622 G22C probably damaging Het
Elmo2 A G 2: 165,309,003 I196T probably damaging Het
Epha3 A G 16: 63,652,496 I342T possibly damaging Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Etf1 G A 18: 34,931,838 P35L unknown Het
Etnk2 A C 1: 133,379,389 *386C probably null Het
Fgg A T 3: 83,012,834 I307F probably benign Het
Flg2 A G 3: 93,202,762 Q699R unknown Het
Foxp4 T A 17: 47,880,853 T120S unknown Het
Fzd1 A G 5: 4,757,060 V174A possibly damaging Het
Gad1 A C 2: 70,574,266 I167L probably benign Het
Gfm2 T A 13: 97,145,663 D55E probably benign Het
Gm6904 T C 14: 59,247,969 Y114C probably damaging Het
Grb14 G T 2: 64,975,585 A12E probably benign Het
Hnmt A C 2: 24,003,884 Y199* probably null Het
Kit A G 5: 75,641,169 I615V probably benign Het
Kpna6 A G 4: 129,661,304 probably null Het
Lpxn C T 19: 12,832,688 R275C probably damaging Het
Magi1 C T 6: 94,283,085 G80S probably damaging Het
Men1 A G 19: 6,338,286 I312V probably benign Het
Msx2 A G 13: 53,468,492 F161L probably damaging Het
Mtr T C 13: 12,190,253 D1107G probably damaging Het
Muc4 A T 16: 32,754,316 M1397L probably benign Het
Mybpc3 A G 2: 91,121,128 N259S probably benign Het
Myo5c A G 9: 75,288,896 K1242R probably benign Het
Myoc T C 1: 162,649,032 V435A possibly damaging Het
Nbea G A 3: 56,058,635 Q469* probably null Het
Ndufa10 A C 1: 92,463,147 M227R possibly damaging Het
Obscn C T 11: 59,062,710 D3831N probably damaging Het
Obscn T C 11: 59,124,574 E1024G probably damaging Het
Oma1 T C 4: 103,319,474 L145P probably damaging Het
Phf12 C A 11: 78,029,639 N1000K probably benign Het
Plxnb1 G T 9: 109,109,619 A1350S probably benign Het
Prkd1 C T 12: 50,342,016 V915I probably damaging Het
Prkra T A 2: 76,633,638 N227Y probably damaging Het
Prtg A T 9: 72,890,795 H681L probably damaging Het
Rtn1 T C 12: 72,308,419 K251R probably benign Het
Sema6b A T 17: 56,124,803 V620E possibly damaging Het
Senp7 T A 16: 56,153,637 L407* probably null Het
Sh3pxd2a A T 19: 47,314,136 L168Q probably damaging Het
Shtn1 A G 19: 58,999,894 L453P probably damaging Het
Slc26a6 G A 9: 108,856,031 R43H probably benign Het
Stac3 T C 10: 127,503,360 probably null Het
Taf2 A G 15: 55,063,020 F178S probably damaging Het
Tcp10a G A 17: 7,334,317 E239K probably benign Het
Ubox5 A G 2: 130,600,413 V118A probably damaging Het
Unc13d C A 11: 116,068,147 L729F probably damaging Het
Vmn1r228 T C 17: 20,776,462 T265A probably benign Het
Vmn2r100 G A 17: 19,531,350 V615I probably damaging Het
Vmn2r60 T G 7: 42,142,266 C538G probably damaging Het
Vmn2r93 A T 17: 18,304,029 N95I probably damaging Het
Vsig2 A G 9: 37,539,968 N55S probably benign Het
Zfp472 A G 17: 32,978,114 T388A probably benign Het
Zfp853 G A 5: 143,289,071 Q214* probably null Het
Zfp949 A G 9: 88,569,240 R288G probably damaging Het
Other mutations in Dmgdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01080:Dmgdh APN 13 93703778 splice site probably benign
IGL01406:Dmgdh APN 13 93687031 splice site probably benign
IGL01408:Dmgdh APN 13 93709295 missense probably damaging 1.00
IGL02167:Dmgdh APN 13 93720627 splice site probably benign
IGL02538:Dmgdh APN 13 93708753 missense possibly damaging 0.50
IGL02550:Dmgdh APN 13 93717575 missense probably damaging 1.00
IGL02563:Dmgdh APN 13 93674539 splice site probably benign
IGL02668:Dmgdh APN 13 93703910 missense probably damaging 1.00
IGL02889:Dmgdh APN 13 93715677 critical splice donor site probably null
IGL03293:Dmgdh APN 13 93706701 missense probably benign 0.11
R0646:Dmgdh UTSW 13 93752355 missense probably benign 0.04
R1531:Dmgdh UTSW 13 93744411 missense probably damaging 1.00
R1746:Dmgdh UTSW 13 93752425 missense probably benign
R1795:Dmgdh UTSW 13 93706699 missense probably benign
R1943:Dmgdh UTSW 13 93711370 missense probably benign 0.08
R1959:Dmgdh UTSW 13 93720559 missense probably benign 0.01
R3421:Dmgdh UTSW 13 93711361 missense probably benign 0.01
R3727:Dmgdh UTSW 13 93692067 missense probably damaging 1.00
R4523:Dmgdh UTSW 13 93688630 nonsense probably null
R5000:Dmgdh UTSW 13 93688538 missense probably damaging 1.00
R5589:Dmgdh UTSW 13 93677157 missense probably damaging 1.00
R5913:Dmgdh UTSW 13 93752323 missense possibly damaging 0.92
R6056:Dmgdh UTSW 13 93708743 missense possibly damaging 0.67
R6056:Dmgdh UTSW 13 93752326 missense probably damaging 1.00
R6057:Dmgdh UTSW 13 93752452 missense probably benign 0.00
R6180:Dmgdh UTSW 13 93752286 missense possibly damaging 0.61
R6259:Dmgdh UTSW 13 93752308 missense probably benign 0.01
R6608:Dmgdh UTSW 13 93706744 missense possibly damaging 0.81
R6636:Dmgdh UTSW 13 93709198 missense probably benign 0.08
R6637:Dmgdh UTSW 13 93709198 missense probably benign 0.08
R6739:Dmgdh UTSW 13 93720615 missense probably benign 0.07
R7157:Dmgdh UTSW 13 93715535 missense probably damaging 1.00
R7200:Dmgdh UTSW 13 93691885 missense probably damaging 1.00
R7312:Dmgdh UTSW 13 93708846 splice site probably null
R7349:Dmgdh UTSW 13 93752233 missense possibly damaging 0.80
R8087:Dmgdh UTSW 13 93703871 missense possibly damaging 0.95
R8288:Dmgdh UTSW 13 93708824 missense probably damaging 1.00
R8371:Dmgdh UTSW 13 93708730 missense probably benign 0.00
R8469:Dmgdh UTSW 13 93706667 missense probably damaging 1.00
R8768:Dmgdh UTSW 13 93688610 missense possibly damaging 0.52
X0066:Dmgdh UTSW 13 93752374 missense possibly damaging 0.90
Z1177:Dmgdh UTSW 13 93677183 missense probably damaging 0.96
Z1177:Dmgdh UTSW 13 93709288 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCATCGATCTGAGACTTGTC -3'
(R):5'- ATCGTTGAAGTGCTTAGCCC -3'

Sequencing Primer
(F):5'- GCATCGATCTGAGACTTGTCTGTTC -3'
(R):5'- GTTGAAGTGCTTAGCCCATTACAC -3'
Posted On2020-07-28