Incidental Mutation 'R8290:Dnajc18'
ID638678
Institutional Source Beutler Lab
Gene Symbol Dnajc18
Ensembl Gene ENSMUSG00000024350
Gene NameDnaJ heat shock protein family (Hsp40) member C18
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R8290 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location35671103-35703144 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 35683271 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 205 (R205*)
Ref Sequence ENSEMBL: ENSMUSP00000025208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025208]
Predicted Effect probably null
Transcript: ENSMUST00000025208
AA Change: R205*
SMART Domains Protein: ENSMUSP00000025208
Gene: ENSMUSG00000024350
AA Change: R205*

DomainStartEndE-ValueType
DnaJ 81 138 6.52e-27 SMART
low complexity region 200 218 N/A INTRINSIC
Pfam:DUF1977 243 349 1.7e-28 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 A T 8: 86,512,282 Y1100N probably damaging Het
Abcf2 CAT CATAAT 5: 24,576,591 probably benign Het
Adgrv1 T C 13: 81,481,883 T3576A probably benign Het
Adnp2 A T 18: 80,142,733 N8K probably damaging Het
Aftph A T 11: 20,725,712 H632Q probably benign Het
Arhgef11 A T 3: 87,725,968 I710F probably damaging Het
Atp6v1c2 T C 12: 17,288,152 N341S possibly damaging Het
Ccsap T G 8: 123,859,247 D55A probably benign Het
Cdh17 A G 4: 11,817,037 N816S probably benign Het
Celf3 A G 3: 94,479,182 I26V probably benign Het
Celsr1 G T 15: 86,033,085 S229* probably null Het
Chek2 A G 5: 110,860,900 E299G possibly damaging Het
Clca2 A G 3: 145,087,958 V312A possibly damaging Het
Cnn1 A G 9: 22,101,151 K25R probably benign Het
Cry1 A T 10: 85,143,113 Y516* probably null Het
Dcaf4 T C 12: 83,541,559 S498P probably benign Het
Dmgdh T C 13: 93,706,736 V360A probably benign Het
Eif4a2 G T 16: 23,108,622 G22C probably damaging Het
Elmo2 A G 2: 165,309,003 I196T probably damaging Het
Epha3 A G 16: 63,652,496 I342T possibly damaging Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Etf1 G A 18: 34,931,838 P35L unknown Het
Etnk2 A C 1: 133,379,389 *386C probably null Het
Fgg A T 3: 83,012,834 I307F probably benign Het
Flg2 A G 3: 93,202,762 Q699R unknown Het
Foxp4 T A 17: 47,880,853 T120S unknown Het
Fzd1 A G 5: 4,757,060 V174A possibly damaging Het
Gad1 A C 2: 70,574,266 I167L probably benign Het
Gfm2 T A 13: 97,145,663 D55E probably benign Het
Gm6904 T C 14: 59,247,969 Y114C probably damaging Het
Grb14 G T 2: 64,975,585 A12E probably benign Het
Hnmt A C 2: 24,003,884 Y199* probably null Het
Kit A G 5: 75,641,169 I615V probably benign Het
Kpna6 A G 4: 129,661,304 probably null Het
Lpxn C T 19: 12,832,688 R275C probably damaging Het
Magi1 C T 6: 94,283,085 G80S probably damaging Het
Men1 A G 19: 6,338,286 I312V probably benign Het
Msx2 A G 13: 53,468,492 F161L probably damaging Het
Mtr T C 13: 12,190,253 D1107G probably damaging Het
Muc4 A T 16: 32,754,316 M1397L probably benign Het
Mybpc3 A G 2: 91,121,128 N259S probably benign Het
Myo5c A G 9: 75,288,896 K1242R probably benign Het
Myoc T C 1: 162,649,032 V435A possibly damaging Het
Nbea G A 3: 56,058,635 Q469* probably null Het
Ndufa10 A C 1: 92,463,147 M227R possibly damaging Het
Obscn C T 11: 59,062,710 D3831N probably damaging Het
Obscn T C 11: 59,124,574 E1024G probably damaging Het
Oma1 T C 4: 103,319,474 L145P probably damaging Het
Phf12 C A 11: 78,029,639 N1000K probably benign Het
Plxnb1 G T 9: 109,109,619 A1350S probably benign Het
Prkd1 C T 12: 50,342,016 V915I probably damaging Het
Prkra T A 2: 76,633,638 N227Y probably damaging Het
Prtg A T 9: 72,890,795 H681L probably damaging Het
Rtn1 T C 12: 72,308,419 K251R probably benign Het
Sema6b A T 17: 56,124,803 V620E possibly damaging Het
Senp7 T A 16: 56,153,637 L407* probably null Het
Sh3pxd2a A T 19: 47,314,136 L168Q probably damaging Het
Shtn1 A G 19: 58,999,894 L453P probably damaging Het
Slc26a6 G A 9: 108,856,031 R43H probably benign Het
Stac3 T C 10: 127,503,360 probably null Het
Taf2 A G 15: 55,063,020 F178S probably damaging Het
Tcp10a G A 17: 7,334,317 E239K probably benign Het
Ubox5 A G 2: 130,600,413 V118A probably damaging Het
Unc13d C A 11: 116,068,147 L729F probably damaging Het
Vmn1r228 T C 17: 20,776,462 T265A probably benign Het
Vmn2r100 G A 17: 19,531,350 V615I probably damaging Het
Vmn2r60 T G 7: 42,142,266 C538G probably damaging Het
Vmn2r93 A T 17: 18,304,029 N95I probably damaging Het
Vsig2 A G 9: 37,539,968 N55S probably benign Het
Zfp472 A G 17: 32,978,114 T388A probably benign Het
Zfp853 G A 5: 143,289,071 Q214* probably null Het
Zfp949 A G 9: 88,569,240 R288G probably damaging Het
Other mutations in Dnajc18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01061:Dnajc18 APN 18 35680942 splice site probably benign
IGL01152:Dnajc18 APN 18 35680873 missense probably benign 0.02
IGL01621:Dnajc18 APN 18 35680840 missense probably benign
IGL03201:Dnajc18 APN 18 35680919 missense probably benign 0.19
R1464:Dnajc18 UTSW 18 35680847 missense possibly damaging 0.88
R1464:Dnajc18 UTSW 18 35680847 missense possibly damaging 0.88
R1801:Dnajc18 UTSW 18 35680804 missense probably damaging 1.00
R3893:Dnajc18 UTSW 18 35700995 splice site probably null
R4974:Dnajc18 UTSW 18 35683319 missense possibly damaging 0.75
R5234:Dnajc18 UTSW 18 35683298 missense probably benign 0.12
R6326:Dnajc18 UTSW 18 35680925 missense possibly damaging 0.95
R6360:Dnajc18 UTSW 18 35686709 missense probably damaging 1.00
R6460:Dnajc18 UTSW 18 35700910 missense probably benign 0.41
R7215:Dnajc18 UTSW 18 35681981 missense probably benign
R7492:Dnajc18 UTSW 18 35686793 missense probably damaging 1.00
X0063:Dnajc18 UTSW 18 35686733 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ATTTTACCAGCACAGCTCAAGTG -3'
(R):5'- TTTTCTGCTGGGTCAGACC -3'

Sequencing Primer
(F):5'- TGGGAGTCTAGCACCGATTATACC -3'
(R):5'- GCAGGTGCCCCATCTTTAG -3'
Posted On2020-07-28