Incidental Mutation 'R8291:Ddx18'
ID638684
Institutional Source Beutler Lab
Gene Symbol Ddx18
Ensembl Gene ENSMUSG00000001674
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 18
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.973) question?
Stock #R8291 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location121553835-121567989 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121560175 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 378 (V378A)
Ref Sequence ENSEMBL: ENSMUSP00000001724 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001724]
Predicted Effect probably damaging
Transcript: ENSMUST00000001724
AA Change: V378A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000001724
Gene: ENSMUSG00000001674
AA Change: V378A

DomainStartEndE-ValueType
coiled coil region 2 32 N/A INTRINSIC
internal_repeat_1 36 75 1.67e-5 PROSPERO
internal_repeat_1 66 105 1.67e-5 PROSPERO
low complexity region 109 117 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
DEXDc 188 393 1.95e-56 SMART
low complexity region 401 417 N/A INTRINSIC
HELICc 429 510 2.84e-26 SMART
DUF4217 550 613 1.65e-26 SMART
low complexity region 620 638 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000114149
Gene: ENSMUSG00000001674
AA Change: V32A

DomainStartEndE-ValueType
Blast:DEXDc 2 47 2e-22 BLAST
HELICc 65 146 2.84e-26 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, and it is activated by Myc protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T G 6: 121,678,058 V1447G probably damaging Het
Adgrf2 A T 17: 42,710,560 F458I probably damaging Het
Adgrl2 T C 3: 148,850,918 E571G possibly damaging Het
Ap1b1 T A 11: 5,018,027 N179K probably damaging Het
Celsr3 T C 9: 108,837,970 F2053L probably damaging Het
Dnah5 T C 15: 28,263,597 F826S probably benign Het
Dnah8 A G 17: 30,765,727 N3133S probably damaging Het
Fam111a A G 19: 12,587,579 T275A probably benign Het
Gm5862 A T 5: 26,019,446 V175E probably benign Het
Gprin3 A G 6: 59,355,005 S106P possibly damaging Het
Kmt2b A G 7: 30,585,469 L666P probably damaging Het
Lrp1 T C 10: 127,589,703 D686G probably damaging Het
Marf1 A G 16: 14,132,568 probably null Het
Olfr965 T C 9: 39,719,545 V106A probably benign Het
Ppp3cb A G 14: 20,523,594 V323A possibly damaging Het
Prkab2 A G 3: 97,662,289 E57G possibly damaging Het
Sh2b2 A T 5: 136,232,355 N2K possibly damaging Het
Spag17 A T 3: 100,060,850 I1208F probably benign Het
Sumf2 T C 5: 129,858,297 probably null Het
Tacr3 A G 3: 134,932,149 R356G possibly damaging Het
Tmc4 A G 7: 3,671,422 V310A probably benign Het
Tmem205 G A 9: 21,921,058 L186F probably benign Het
Ttn T C 2: 76,787,209 E16306G probably damaging Het
Ubap2l T C 3: 90,008,231 *497W probably null Het
Ubr1 G A 2: 120,911,115 T979I probably benign Het
Vmn1r159 A T 7: 22,842,830 I259N possibly damaging Het
Vmp1 G A 11: 86,607,238 P284S probably damaging Het
Wdsub1 A G 2: 59,862,674 S299P probably damaging Het
Zfp438 G T 18: 5,211,010 S676* probably null Het
Zfp94 T A 7: 24,302,730 Y429F probably damaging Het
Other mutations in Ddx18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01531:Ddx18 APN 1 121564586 missense probably benign 0.00
IGL01999:Ddx18 APN 1 121561728 missense probably benign 0.19
IGL03056:Ddx18 APN 1 121564535 missense probably benign 0.00
IGL03388:Ddx18 APN 1 121565923 missense possibly damaging 0.86
R0550:Ddx18 UTSW 1 121555375 missense probably benign 0.40
R1883:Ddx18 UTSW 1 121567916 start gained probably benign
R1940:Ddx18 UTSW 1 121555224 missense probably damaging 1.00
R2169:Ddx18 UTSW 1 121558409 critical splice donor site probably null
R3113:Ddx18 UTSW 1 121566148 missense possibly damaging 0.65
R3414:Ddx18 UTSW 1 121562149 missense probably benign
R3763:Ddx18 UTSW 1 121561377 missense probably damaging 0.99
R4011:Ddx18 UTSW 1 121562081 missense probably benign 0.01
R4293:Ddx18 UTSW 1 121561392 missense probably benign 0.10
R4333:Ddx18 UTSW 1 121564602 missense probably benign 0.01
R4964:Ddx18 UTSW 1 121566094 missense probably benign 0.00
R5160:Ddx18 UTSW 1 121565879 critical splice donor site probably null
R5187:Ddx18 UTSW 1 121562128 missense probably damaging 0.98
R5259:Ddx18 UTSW 1 121567789 critical splice donor site probably null
R5656:Ddx18 UTSW 1 121561358 missense probably damaging 1.00
R7949:Ddx18 UTSW 1 121555318 missense probably damaging 1.00
R8318:Ddx18 UTSW 1 121566087 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- GGCTGGGTCATTCAGAGTTC -3'
(R):5'- TTCCAGGACTCTCTTCCTAAAGTG -3'

Sequencing Primer
(F):5'- AGTCACTACTCAAGTCTGCTACTCTG -3'
(R):5'- GGACTCTCTTCCTAAAGTGTAATTG -3'
Posted On2020-07-28