Incidental Mutation 'R0708:Papss2'
ID63869
Institutional Source Beutler Lab
Gene Symbol Papss2
Ensembl Gene ENSMUSG00000024899
Gene Name3'-phosphoadenosine 5'-phosphosulfate synthase 2
SynonymsSk2, Atpsk2, 1810018P12Rik
MMRRC Submission 038891-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.158) question?
Stock #R0708 (G1)
Quality Score107
Status Not validated
Chromosome19
Chromosomal Location32620005-32667187 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32637216 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 111 (F111L)
Ref Sequence ENSEMBL: ENSMUSP00000025833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025833]
Predicted Effect probably damaging
Transcript: ENSMUST00000025833
AA Change: F111L

PolyPhen 2 Score 0.973 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000025833
Gene: ENSMUSG00000024899
AA Change: F111L

DomainStartEndE-ValueType
Pfam:APS_kinase 42 200 2.3e-74 PFAM
low complexity region 204 214 N/A INTRINSIC
Pfam:PUA_2 216 382 4e-52 PFAM
Pfam:ATP-sulfurylase 390 613 1.9e-70 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sulfation is a common modification of endogenous (lipids, proteins, and carbohydrates) and exogenous (xenobiotics and drugs) compounds. In mammals, the sulfate source is 3'-phosphoadenosine 5'-phosphosulfate (PAPS), created from ATP and inorganic sulfate. Two different tissue isoforms encoded by different genes synthesize PAPS. This gene encodes one of the two PAPS synthetases. Defects in this gene cause the Pakistani type of spondyloepimetaphyseal dysplasia. Two alternatively spliced transcript variants that encode different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for mutation s in this gene display delayed growth and shorter limbs and other abnormalities in bone formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brdt A T 5: 107,358,900 K450* probably null Het
Cand2 G A 6: 115,803,805 E1217K probably damaging Het
Col9a1 A T 1: 24,237,261 Q750L possibly damaging Het
Dnah6 A T 6: 73,212,622 S14R probably benign Het
Enox1 A G 14: 77,592,912 N319S probably benign Het
Frs2 G A 10: 117,074,092 T455M probably damaging Het
Glra3 C T 8: 56,125,364 probably benign Het
Gmppa T C 1: 75,442,574 F375S probably damaging Het
Hectd4 G A 5: 121,286,463 probably null Het
Hgf C A 5: 16,566,763 C129* probably null Het
Insc T A 7: 114,845,146 V456E probably damaging Het
Ints14 G A 9: 64,983,984 V416I probably benign Het
Klk1b11 T C 7: 43,997,728 F29L possibly damaging Het
Ogfod1 C T 8: 94,039,045 L79F possibly damaging Het
Olfr926 T A 9: 38,877,275 V33E probably damaging Het
Orc3 A T 4: 34,597,368 I224N probably damaging Het
Poc1b A G 10: 99,155,130 D291G probably null Het
Prl8a8 A T 13: 27,511,545 M72K possibly damaging Het
Ptpn7 C A 1: 135,134,547 T77K probably damaging Het
Ptpro T C 6: 137,386,253 S462P probably benign Het
Rab3gap2 T A 1: 185,249,926 S392T probably damaging Het
Sema4d A G 13: 51,712,719 V245A probably benign Het
Sgcb A T 5: 73,640,882 probably null Het
Slc24a1 T A 9: 64,947,890 K578N unknown Het
Sptbn1 A T 11: 30,114,739 V1920E probably damaging Het
Tecr A T 8: 83,573,109 I101N probably damaging Het
Tectb T C 19: 55,191,552 F277L probably benign Het
Tgs1 T A 4: 3,586,152 L343H probably benign Het
Thbs4 C A 13: 92,773,186 G368W probably damaging Het
Zfp558 T C 9: 18,456,827 S222G possibly damaging Het
Other mutations in Papss2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01597:Papss2 APN 19 32638258 missense probably damaging 1.00
IGL01646:Papss2 APN 19 32652082 missense probably benign
IGL02052:Papss2 APN 19 32660583 missense possibly damaging 0.92
IGL02631:Papss2 APN 19 32634004 splice site probably benign
R0091:Papss2 UTSW 19 32633902 missense possibly damaging 0.94
R0116:Papss2 UTSW 19 32638368 nonsense probably null
R1336:Papss2 UTSW 19 32638315 missense possibly damaging 0.73
R1488:Papss2 UTSW 19 32637090 missense probably benign 0.02
R1931:Papss2 UTSW 19 32638968 nonsense probably null
R4025:Papss2 UTSW 19 32651923 missense probably damaging 0.98
R4369:Papss2 UTSW 19 32641391 missense probably damaging 1.00
R4762:Papss2 UTSW 19 32638978 missense probably benign 0.05
R5235:Papss2 UTSW 19 32639219 missense probably benign 0.00
R5294:Papss2 UTSW 19 32639000 missense probably benign 0.03
R5320:Papss2 UTSW 19 32638387 missense probably damaging 1.00
R5721:Papss2 UTSW 19 32660664 missense probably damaging 1.00
R5768:Papss2 UTSW 19 32660719 splice site probably null
R5982:Papss2 UTSW 19 32639236 missense probably benign
R6124:Papss2 UTSW 19 32637128 missense probably damaging 1.00
R6395:Papss2 UTSW 19 32664476 missense probably damaging 1.00
R6546:Papss2 UTSW 19 32663148 missense possibly damaging 0.78
R6571:Papss2 UTSW 19 32651942 splice site probably null
R7055:Papss2 UTSW 19 32664427 missense probably damaging 1.00
R7315:Papss2 UTSW 19 32639225 missense possibly damaging 0.60
R7726:Papss2 UTSW 19 32634003 splice site probably null
R7753:Papss2 UTSW 19 32620179 missense probably benign 0.00
R7991:Papss2 UTSW 19 32652003 missense possibly damaging 0.93
R8155:Papss2 UTSW 19 32641342 missense probably benign 0.24
R8275:Papss2 UTSW 19 32638360 missense probably damaging 1.00
X0028:Papss2 UTSW 19 32638395 splice site probably null
Predicted Primers PCR Primer
(F):5'- CACCACCATTCCTGAGTTGGTCAC -3'
(R):5'- TGTCACCCATAACGGCCTCATGTC -3'

Sequencing Primer
(F):5'- CAACAGGTCTCTCTGGTGC -3'
(R):5'- TCTGATcccccaccccc -3'
Posted On2013-07-30