Incidental Mutation 'R8291:Gm5862'
ID638693
Institutional Source Beutler Lab
Gene Symbol Gm5862
Ensembl Gene ENSMUSG00000067700
Gene Namepredicted gene 5862
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.188) question?
Stock #R8291 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location26017278-26022916 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 26019446 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 175 (V175E)
Ref Sequence ENSEMBL: ENSMUSP00000072133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072286]
Predicted Effect probably benign
Transcript: ENSMUST00000072286
AA Change: V175E

PolyPhen 2 Score 0.324 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000072133
Gene: ENSMUSG00000067700
AA Change: V175E

DomainStartEndE-ValueType
Pfam:Takusan 50 134 1.6e-25 PFAM
low complexity region 154 168 N/A INTRINSIC
low complexity region 235 259 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (31/31)
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T G 6: 121,678,058 V1447G probably damaging Het
Adgrf2 A T 17: 42,710,560 F458I probably damaging Het
Adgrl2 T C 3: 148,850,918 E571G possibly damaging Het
Ap1b1 T A 11: 5,018,027 N179K probably damaging Het
Celsr3 T C 9: 108,837,970 F2053L probably damaging Het
Ddx18 A G 1: 121,560,175 V378A probably damaging Het
Dnah5 T C 15: 28,263,597 F826S probably benign Het
Dnah8 A G 17: 30,765,727 N3133S probably damaging Het
Fam111a A G 19: 12,587,579 T275A probably benign Het
Gprin3 A G 6: 59,355,005 S106P possibly damaging Het
Kmt2b A G 7: 30,585,469 L666P probably damaging Het
Lrp1 T C 10: 127,589,703 D686G probably damaging Het
Marf1 A G 16: 14,132,568 probably null Het
Olfr965 T C 9: 39,719,545 V106A probably benign Het
Ppp3cb A G 14: 20,523,594 V323A possibly damaging Het
Prkab2 A G 3: 97,662,289 E57G possibly damaging Het
Sh2b2 A T 5: 136,232,355 N2K possibly damaging Het
Smyd2 A T 1: 189,900,091 probably benign Het
Spag17 A T 3: 100,060,850 I1208F probably benign Het
Sumf2 T C 5: 129,858,297 probably null Het
Tacr3 A G 3: 134,932,149 R356G possibly damaging Het
Tmc4 A G 7: 3,671,422 V310A probably benign Het
Tmem205 G A 9: 21,921,058 L186F probably benign Het
Ttn T C 2: 76,787,209 E16306G probably damaging Het
Ubap2l T C 3: 90,008,231 *497W probably null Het
Ubr1 G A 2: 120,911,115 T979I probably benign Het
Vmn1r159 A T 7: 22,842,830 I259N possibly damaging Het
Vmp1 G A 11: 86,607,238 P284S probably damaging Het
Wdsub1 A G 2: 59,862,674 S299P probably damaging Het
Zfp438 G T 18: 5,211,010 S676* probably null Het
Zfp94 T A 7: 24,302,730 Y429F probably damaging Het
Other mutations in Gm5862
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01606:Gm5862 APN 5 26019516 missense probably benign
IGL01863:Gm5862 APN 5 26022771 missense probably benign
IGL01868:Gm5862 APN 5 26022771 missense probably benign
IGL01873:Gm5862 APN 5 26022771 missense probably benign
IGL01881:Gm5862 APN 5 26022771 missense probably benign
IGL01902:Gm5862 APN 5 26022771 missense probably benign
IGL01905:Gm5862 APN 5 26022771 missense probably benign
IGL01909:Gm5862 APN 5 26022771 missense probably benign
IGL01917:Gm5862 APN 5 26022771 missense probably benign
IGL01924:Gm5862 APN 5 26022771 missense probably benign
IGL01927:Gm5862 APN 5 26022771 missense probably benign
IGL01951:Gm5862 APN 5 26022771 missense probably benign
IGL03374:Gm5862 APN 5 26019512 missense probably damaging 0.98
R2475:Gm5862 UTSW 5 26019492 missense probably damaging 1.00
R3828:Gm5862 UTSW 5 26019347 missense probably benign 0.27
R4591:Gm5862 UTSW 5 26019488 missense possibly damaging 0.95
R6916:Gm5862 UTSW 5 26019348 missense probably benign
Z1176:Gm5862 UTSW 5 26018487 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TACATTCCATGAGGAGGGTGG -3'
(R):5'- CTTCATGGGATCCAGGGTAC -3'

Sequencing Primer
(F):5'- CTTGGAAGCATGGACTAGAAAGTTG -3'
(R):5'- CATGGGATCCAGGGTACAGGTC -3'
Posted On2020-07-28