Incidental Mutation 'R8291:Sh2b2'
ID638695
Institutional Source Beutler Lab
Gene Symbol Sh2b2
Ensembl Gene ENSMUSG00000005057
Gene NameSH2B adaptor protein 2
SynonymsAps
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.937) question?
Stock #R8291 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location136218147-136246556 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 136232355 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 2 (N2K)
Ref Sequence ENSEMBL: ENSMUSP00000142728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005188] [ENSMUST00000196245] [ENSMUST00000196397] [ENSMUST00000196447]
Predicted Effect possibly damaging
Transcript: ENSMUST00000005188
AA Change: N2K

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000005188
Gene: ENSMUSG00000005057
AA Change: N2K

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
Pfam:Phe_ZIP 17 73 9.3e-22 PFAM
Blast:PH 95 168 2e-21 BLAST
low complexity region 169 180 N/A INTRINSIC
PH 187 301 4.97e-9 SMART
low complexity region 340 350 N/A INTRINSIC
low complexity region 388 404 N/A INTRINSIC
SH2 407 492 1.38e-21 SMART
low complexity region 509 525 N/A INTRINSIC
low complexity region 548 576 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000196245
AA Change: N2K

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000196397
AA Change: N2K

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000142398
Gene: ENSMUSG00000005057
AA Change: N2K

DomainStartEndE-ValueType
Pfam:Phe_ZIP 16 74 1.5e-30 PFAM
Blast:PH 95 168 2e-21 BLAST
low complexity region 169 180 N/A INTRINSIC
PH 187 301 4.97e-9 SMART
low complexity region 340 350 N/A INTRINSIC
low complexity region 388 404 N/A INTRINSIC
SH2 407 492 1.38e-21 SMART
low complexity region 509 525 N/A INTRINSIC
low complexity region 548 576 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000196447
AA Change: N2K

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000142728
Gene: ENSMUSG00000005057
AA Change: N2K

DomainStartEndE-ValueType
Pfam:Phe_ZIP 16 74 9.1e-28 PFAM
Blast:PH 95 168 9e-22 BLAST
low complexity region 169 180 N/A INTRINSIC
PH 187 301 2.2e-11 SMART
low complexity region 340 350 N/A INTRINSIC
low complexity region 406 417 N/A INTRINSIC
Meta Mutation Damage Score 0.0727 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is expressed in B lymphocytes and contains pleckstrin homology and src homology 2 (SH2) domains. In Burkitt's lymphoma cell lines, it is tyrosine-phosphorylated in response to B cell receptor stimulation. Because it binds Shc independent of stimulation and Grb2 after stimulation, it appears to play a role in signal transduction from the receptor to the Shc/Grb2 pathway. [provided by RefSeq, Jun 2009]
PHENOTYPE: Inactivation of this gene results in increased insulin sensitivity accompanied by hypoinsulinemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T G 6: 121,678,058 V1447G probably damaging Het
Adgrf2 A T 17: 42,710,560 F458I probably damaging Het
Adgrl2 T C 3: 148,850,918 E571G possibly damaging Het
Ap1b1 T A 11: 5,018,027 N179K probably damaging Het
Celsr3 T C 9: 108,837,970 F2053L probably damaging Het
Ddx18 A G 1: 121,560,175 V378A probably damaging Het
Dnah5 T C 15: 28,263,597 F826S probably benign Het
Dnah8 A G 17: 30,765,727 N3133S probably damaging Het
Fam111a A G 19: 12,587,579 T275A probably benign Het
Gm5862 A T 5: 26,019,446 V175E probably benign Het
Gprin3 A G 6: 59,355,005 S106P possibly damaging Het
Kmt2b A G 7: 30,585,469 L666P probably damaging Het
Lrp1 T C 10: 127,589,703 D686G probably damaging Het
Marf1 A G 16: 14,132,568 probably null Het
Olfr965 T C 9: 39,719,545 V106A probably benign Het
Ppp3cb A G 14: 20,523,594 V323A possibly damaging Het
Prkab2 A G 3: 97,662,289 E57G possibly damaging Het
Smyd2 A T 1: 189,900,091 probably benign Het
Spag17 A T 3: 100,060,850 I1208F probably benign Het
Sumf2 T C 5: 129,858,297 probably null Het
Tacr3 A G 3: 134,932,149 R356G possibly damaging Het
Tmc4 A G 7: 3,671,422 V310A probably benign Het
Tmem205 G A 9: 21,921,058 L186F probably benign Het
Ttn T C 2: 76,787,209 E16306G probably damaging Het
Ubap2l T C 3: 90,008,231 *497W probably null Het
Ubr1 G A 2: 120,911,115 T979I probably benign Het
Vmn1r159 A T 7: 22,842,830 I259N possibly damaging Het
Vmp1 G A 11: 86,607,238 P284S probably damaging Het
Wdsub1 A G 2: 59,862,674 S299P probably damaging Het
Zfp438 G T 18: 5,211,010 S676* probably null Het
Zfp94 T A 7: 24,302,730 Y429F probably damaging Het
Other mutations in Sh2b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Sh2b2 APN 5 136224419 missense probably damaging 1.00
IGL01456:Sh2b2 APN 5 136224467 missense probably damaging 0.98
IGL01612:Sh2b2 APN 5 136231802 missense probably benign 0.02
IGL02798:Sh2b2 APN 5 136221963 missense probably damaging 1.00
BB002:Sh2b2 UTSW 5 136224261 missense probably benign 0.04
BB012:Sh2b2 UTSW 5 136224261 missense probably benign 0.04
R0492:Sh2b2 UTSW 5 136232263 missense probably damaging 1.00
R0539:Sh2b2 UTSW 5 136225301 splice site probably benign
R0707:Sh2b2 UTSW 5 136232263 missense probably damaging 1.00
R1569:Sh2b2 UTSW 5 136231735 missense possibly damaging 0.89
R1777:Sh2b2 UTSW 5 136227422 missense probably damaging 1.00
R2088:Sh2b2 UTSW 5 136232114 missense possibly damaging 0.87
R3702:Sh2b2 UTSW 5 136224233 missense probably damaging 0.99
R4223:Sh2b2 UTSW 5 136219053 missense possibly damaging 0.91
R4597:Sh2b2 UTSW 5 136231762 missense probably damaging 0.99
R4683:Sh2b2 UTSW 5 136231720 missense probably damaging 1.00
R4766:Sh2b2 UTSW 5 136231957 missense probably damaging 0.99
R5486:Sh2b2 UTSW 5 136232090 missense probably benign 0.10
R6060:Sh2b2 UTSW 5 136232355 missense possibly damaging 0.72
R6322:Sh2b2 UTSW 5 136224188 missense probably damaging 0.99
R7020:Sh2b2 UTSW 5 136224299 missense possibly damaging 0.69
R7034:Sh2b2 UTSW 5 136218885 missense probably benign 0.18
R7036:Sh2b2 UTSW 5 136218885 missense probably benign 0.18
R7615:Sh2b2 UTSW 5 136219657 missense probably damaging 1.00
R7715:Sh2b2 UTSW 5 136219035 missense probably benign 0.09
R7925:Sh2b2 UTSW 5 136224261 missense probably benign 0.04
R8244:Sh2b2 UTSW 5 136227437 nonsense probably null
R8786:Sh2b2 UTSW 5 136231804 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- GAAGTTGGCTGCAAAGTGGC -3'
(R):5'- CTGGCCAGAGGATTCAAAGTC -3'

Sequencing Primer
(F):5'- TGGCGGGAGAATGAGGTCC -3'
(R):5'- TTGGCATCCTAGCACATGAG -3'
Posted On2020-07-28