Incidental Mutation 'R8291:Or8g52'
ID 638703
Institutional Source Beutler Lab
Gene Symbol Or8g52
Ensembl Gene ENSMUSG00000095839
Gene Name olfactory receptor family 8 subfamily G member 52
Synonyms MOR171-28, Olfr965, GA_x6K02T2PVTD-33416730-33417668
MMRRC Submission 067713-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.070) question?
Stock # R8291 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 39630525-39631463 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 39630841 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 106 (V106A)
Ref Sequence ENSEMBL: ENSMUSP00000069696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069342]
AlphaFold Q7TRA7
Predicted Effect probably benign
Transcript: ENSMUST00000069342
AA Change: V106A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000069696
Gene: ENSMUSG00000095839
AA Change: V106A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.4e-47 PFAM
Pfam:7tm_1 41 290 4.2e-24 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 31 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T G 6: 121,655,017 (GRCm39) V1447G probably damaging Het
Adgrf2 A T 17: 43,021,451 (GRCm39) F458I probably damaging Het
Adgrl2 T C 3: 148,556,554 (GRCm39) E571G possibly damaging Het
Ap1b1 T A 11: 4,968,027 (GRCm39) N179K probably damaging Het
Celsr3 T C 9: 108,715,169 (GRCm39) F2053L probably damaging Het
Ddx18 A G 1: 121,487,904 (GRCm39) V378A probably damaging Het
Dnah5 T C 15: 28,263,743 (GRCm39) F826S probably benign Het
Dnah8 A G 17: 30,984,701 (GRCm39) N3133S probably damaging Het
Fam111a A G 19: 12,564,943 (GRCm39) T275A probably benign Het
Gm5862 A T 5: 26,224,444 (GRCm39) V175E probably benign Het
Gprin3 A G 6: 59,331,990 (GRCm39) S106P possibly damaging Het
Kmt2b A G 7: 30,284,894 (GRCm39) L666P probably damaging Het
Lrp1 T C 10: 127,425,572 (GRCm39) D686G probably damaging Het
Marf1 A G 16: 13,950,432 (GRCm39) probably null Het
Ppp3cb A G 14: 20,573,662 (GRCm39) V323A possibly damaging Het
Prkab2 A G 3: 97,569,605 (GRCm39) E57G possibly damaging Het
Sh2b2 A T 5: 136,261,209 (GRCm39) N2K possibly damaging Het
Smyd2 A T 1: 189,632,288 (GRCm39) probably benign Het
Spag17 A T 3: 99,968,166 (GRCm39) I1208F probably benign Het
Sumf2 T C 5: 129,887,138 (GRCm39) probably null Het
Tacr3 A G 3: 134,637,910 (GRCm39) R356G possibly damaging Het
Tmc4 A G 7: 3,674,421 (GRCm39) V310A probably benign Het
Tmem205 G A 9: 21,832,354 (GRCm39) L186F probably benign Het
Ttn T C 2: 76,617,553 (GRCm39) E16306G probably damaging Het
Ubap2l T C 3: 89,915,538 (GRCm39) *497W probably null Het
Ubr1 G A 2: 120,741,596 (GRCm39) T979I probably benign Het
Vmn1r159 A T 7: 22,542,255 (GRCm39) I259N possibly damaging Het
Vmp1 G A 11: 86,498,064 (GRCm39) P284S probably damaging Het
Wdsub1 A G 2: 59,693,018 (GRCm39) S299P probably damaging Het
Zfp438 G T 18: 5,211,010 (GRCm39) S676* probably null Het
Zfp94 T A 7: 24,002,155 (GRCm39) Y429F probably damaging Het
Other mutations in Or8g52
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01705:Or8g52 APN 9 39,630,877 (GRCm39) missense possibly damaging 0.95
IGL02365:Or8g52 APN 9 39,631,396 (GRCm39) missense probably damaging 0.98
IGL02365:Or8g52 APN 9 39,630,970 (GRCm39) missense possibly damaging 0.60
IGL03062:Or8g52 APN 9 39,631,331 (GRCm39) missense probably benign 0.26
IGL03330:Or8g52 APN 9 39,630,784 (GRCm39) missense probably benign 0.08
R0011:Or8g52 UTSW 9 39,630,923 (GRCm39) missense probably benign 0.26
R0462:Or8g52 UTSW 9 39,630,706 (GRCm39) missense probably benign 0.01
R1505:Or8g52 UTSW 9 39,630,774 (GRCm39) missense probably damaging 1.00
R1995:Or8g52 UTSW 9 39,630,709 (GRCm39) missense probably damaging 1.00
R2049:Or8g52 UTSW 9 39,631,411 (GRCm39) missense probably damaging 1.00
R2110:Or8g52 UTSW 9 39,631,018 (GRCm39) missense probably benign 0.30
R3817:Or8g52 UTSW 9 39,631,404 (GRCm39) missense possibly damaging 0.95
R4152:Or8g52 UTSW 9 39,631,296 (GRCm39) missense probably benign 0.10
R4153:Or8g52 UTSW 9 39,631,296 (GRCm39) missense probably benign 0.10
R4351:Or8g52 UTSW 9 39,630,865 (GRCm39) missense probably damaging 0.99
R4377:Or8g52 UTSW 9 39,631,103 (GRCm39) missense probably benign 0.04
R4667:Or8g52 UTSW 9 39,631,005 (GRCm39) missense probably benign 0.09
R5526:Or8g52 UTSW 9 39,630,892 (GRCm39) missense possibly damaging 0.95
R5816:Or8g52 UTSW 9 39,630,526 (GRCm39) start codon destroyed probably null 1.00
R7113:Or8g52 UTSW 9 39,630,973 (GRCm39) missense probably benign
R7336:Or8g52 UTSW 9 39,630,906 (GRCm39) missense probably benign 0.28
R8153:Or8g52 UTSW 9 39,630,954 (GRCm39) missense possibly damaging 0.68
R8779:Or8g52 UTSW 9 39,630,636 (GRCm39) missense probably damaging 0.99
R9617:Or8g52 UTSW 9 39,630,678 (GRCm39) missense possibly damaging 0.80
R9631:Or8g52 UTSW 9 39,631,161 (GRCm39) missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- TGGAATCTACTTGTTCACGGAGC -3'
(R):5'- TCGCAGCATGCAAACAGTATG -3'

Sequencing Primer
(F):5'- AACCTGGGCATGGTCATCTTGATC -3'
(R):5'- CATGCAAACAGTATGAAGTGTGGC -3'
Posted On 2020-07-28