Incidental Mutation 'R8291:Olfr965'
ID638703
Institutional Source Beutler Lab
Gene Symbol Olfr965
Ensembl Gene ENSMUSG00000095839
Gene Nameolfactory receptor 965
SynonymsGA_x6K02T2PVTD-33416730-33417668, MOR171-28
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R8291 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location39711353-39720614 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39719545 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 106 (V106A)
Ref Sequence ENSEMBL: ENSMUSP00000069696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069342]
Predicted Effect probably benign
Transcript: ENSMUST00000069342
AA Change: V106A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000069696
Gene: ENSMUSG00000095839
AA Change: V106A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.4e-47 PFAM
Pfam:7tm_1 41 290 4.2e-24 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m T G 6: 121,678,058 V1447G probably damaging Het
Adgrf2 A T 17: 42,710,560 F458I probably damaging Het
Adgrl2 T C 3: 148,850,918 E571G possibly damaging Het
Ap1b1 T A 11: 5,018,027 N179K probably damaging Het
Celsr3 T C 9: 108,837,970 F2053L probably damaging Het
Ddx18 A G 1: 121,560,175 V378A probably damaging Het
Dnah5 T C 15: 28,263,597 F826S probably benign Het
Dnah8 A G 17: 30,765,727 N3133S probably damaging Het
Fam111a A G 19: 12,587,579 T275A probably benign Het
Gm5862 A T 5: 26,019,446 V175E probably benign Het
Gprin3 A G 6: 59,355,005 S106P possibly damaging Het
Kmt2b A G 7: 30,585,469 L666P probably damaging Het
Lrp1 T C 10: 127,589,703 D686G probably damaging Het
Marf1 A G 16: 14,132,568 probably null Het
Ppp3cb A G 14: 20,523,594 V323A possibly damaging Het
Prkab2 A G 3: 97,662,289 E57G possibly damaging Het
Sh2b2 A T 5: 136,232,355 N2K possibly damaging Het
Spag17 A T 3: 100,060,850 I1208F probably benign Het
Sumf2 T C 5: 129,858,297 probably null Het
Tacr3 A G 3: 134,932,149 R356G possibly damaging Het
Tmc4 A G 7: 3,671,422 V310A probably benign Het
Tmem205 G A 9: 21,921,058 L186F probably benign Het
Ttn T C 2: 76,787,209 E16306G probably damaging Het
Ubap2l T C 3: 90,008,231 *497W probably null Het
Ubr1 G A 2: 120,911,115 T979I probably benign Het
Vmn1r159 A T 7: 22,842,830 I259N possibly damaging Het
Vmp1 G A 11: 86,607,238 P284S probably damaging Het
Wdsub1 A G 2: 59,862,674 S299P probably damaging Het
Zfp438 G T 18: 5,211,010 S676* probably null Het
Zfp94 T A 7: 24,302,730 Y429F probably damaging Het
Other mutations in Olfr965
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01705:Olfr965 APN 9 39719581 missense possibly damaging 0.95
IGL02365:Olfr965 APN 9 39719674 missense possibly damaging 0.60
IGL02365:Olfr965 APN 9 39720100 missense probably damaging 0.98
IGL03062:Olfr965 APN 9 39720035 missense probably benign 0.26
IGL03330:Olfr965 APN 9 39719488 missense probably benign 0.08
R0011:Olfr965 UTSW 9 39719627 missense probably benign 0.26
R0462:Olfr965 UTSW 9 39719410 missense probably benign 0.01
R1505:Olfr965 UTSW 9 39719478 missense probably damaging 1.00
R1995:Olfr965 UTSW 9 39719413 missense probably damaging 1.00
R2049:Olfr965 UTSW 9 39720115 missense probably damaging 1.00
R2110:Olfr965 UTSW 9 39719722 missense probably benign 0.30
R3817:Olfr965 UTSW 9 39720108 missense possibly damaging 0.95
R4152:Olfr965 UTSW 9 39720000 missense probably benign 0.10
R4153:Olfr965 UTSW 9 39720000 missense probably benign 0.10
R4351:Olfr965 UTSW 9 39719569 missense probably damaging 0.99
R4377:Olfr965 UTSW 9 39719807 missense probably benign 0.04
R4667:Olfr965 UTSW 9 39719709 missense probably benign 0.09
R5526:Olfr965 UTSW 9 39719596 missense possibly damaging 0.95
R5816:Olfr965 UTSW 9 39719230 start codon destroyed probably null 1.00
R7113:Olfr965 UTSW 9 39719677 missense probably benign
R7336:Olfr965 UTSW 9 39719610 missense probably benign 0.28
R8153:Olfr965 UTSW 9 39719658 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- TGGAATCTACTTGTTCACGGAGC -3'
(R):5'- TCGCAGCATGCAAACAGTATG -3'

Sequencing Primer
(F):5'- AACCTGGGCATGGTCATCTTGATC -3'
(R):5'- CATGCAAACAGTATGAAGTGTGGC -3'
Posted On2020-07-28