Incidental Mutation 'R8292:Acacb'
ID 638732
Institutional Source Beutler Lab
Gene Symbol Acacb
Ensembl Gene ENSMUSG00000042010
Gene Name acetyl-Coenzyme A carboxylase beta
Synonyms Acc2, Accb
MMRRC Submission 067782-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R8292 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 114284748-114388822 bp(+) (GRCm39)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) A to T at 114338555 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000031583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031583] [ENSMUST00000031583] [ENSMUST00000031583] [ENSMUST00000102582]
AlphaFold E9Q4Z2
Predicted Effect probably null
Transcript: ENSMUST00000031583
SMART Domains Protein: ENSMUSP00000031583
Gene: ENSMUSG00000042010

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 2.1e-32 PFAM
Pfam:CPSase_L_D2 405 606 3.3e-52 PFAM
Pfam:ATP-grasp_4 413 576 2.1e-9 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 1.9e-17 PFAM
Pfam:ACC_central 952 1678 2.2e-290 PFAM
Pfam:Carboxyl_trans 1770 2324 2.3e-181 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000031583
SMART Domains Protein: ENSMUSP00000031583
Gene: ENSMUSG00000042010

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 2.1e-32 PFAM
Pfam:CPSase_L_D2 405 606 3.3e-52 PFAM
Pfam:ATP-grasp_4 413 576 2.1e-9 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 1.9e-17 PFAM
Pfam:ACC_central 952 1678 2.2e-290 PFAM
Pfam:Carboxyl_trans 1770 2324 2.3e-181 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000031583
SMART Domains Protein: ENSMUSP00000031583
Gene: ENSMUSG00000042010

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 2.1e-32 PFAM
Pfam:CPSase_L_D2 405 606 3.3e-52 PFAM
Pfam:ATP-grasp_4 413 576 2.1e-9 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 1.9e-17 PFAM
Pfam:ACC_central 952 1678 2.2e-290 PFAM
Pfam:Carboxyl_trans 1770 2324 2.3e-181 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102582
SMART Domains Protein: ENSMUSP00000099642
Gene: ENSMUSG00000042010

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 8.2e-29 PFAM
Pfam:CPSase_L_D2 405 606 3.8e-52 PFAM
Pfam:ATP-grasp_4 409 576 1.4e-12 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 9.1e-17 PFAM
Pfam:ACC_central 952 1678 2.3e-250 PFAM
Pfam:Carboxyl_trans 1770 2324 4.8e-172 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ACC-beta is thought to control fatty acid oxidation by means of the ability of malonyl-CoA to inhibit carnitine-palmitoyl-CoA transferase I, the rate-limiting step in fatty acid uptake and oxidation by mitochondria. ACC-beta may be involved in the regulation of fatty acid oxidation, rather than fatty acid biosynthesis. There is evidence for the presence of two ACC-beta isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and overtly normal but exhibit high levels of fatty acid oxidation, as well as reduced fat accumulation in their adipose tissue and liver, and decreased storage of glycogen in their liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akirin2 T C 4: 34,566,007 (GRCm39) probably null Het
Akr1c14 A G 13: 4,130,995 (GRCm39) D229G possibly damaging Het
Arfgef1 T C 1: 10,227,194 (GRCm39) I1382V probably benign Het
Bcas3 C A 11: 85,348,729 (GRCm39) A207D probably damaging Het
Bcl2l10 T C 9: 75,255,160 (GRCm39) probably benign Het
Cdc42 T C 4: 137,063,384 (GRCm39) T3A probably benign Het
Celsr1 C A 15: 85,791,819 (GRCm39) W2594L possibly damaging Het
Chrna6 A T 8: 27,896,754 (GRCm39) H374Q probably benign Het
Cibar1 T G 4: 12,153,963 (GRCm39) T330P possibly damaging Het
Clcnka G A 4: 141,125,272 (GRCm39) R30* probably null Het
Clptm1l A T 13: 73,765,854 (GRCm39) H464L probably damaging Het
Col6a4 A T 9: 105,954,076 (GRCm39) M421K probably benign Het
Crybg2 T C 4: 133,802,842 (GRCm39) S873P probably damaging Het
Dixdc1 A G 9: 50,621,989 (GRCm39) V114A probably benign Het
Etv6 T C 6: 134,225,509 (GRCm39) C247R probably benign Het
Farp2 T C 1: 93,456,350 (GRCm39) L11S probably damaging Het
Gbp2 G A 3: 142,329,584 (GRCm39) V44M probably damaging Het
Get4 A G 5: 139,248,686 (GRCm39) D99G probably null Het
Glcci1 G A 6: 8,558,549 (GRCm39) R212H probably damaging Het
Gm14295 T A 2: 176,501,351 (GRCm39) F280L probably damaging Het
Gm5407 T A 16: 49,117,550 (GRCm39) N70Y noncoding transcript Het
Hace1 C G 10: 45,587,557 (GRCm39) Y885* probably null Het
Hectd4 G A 5: 121,455,288 (GRCm39) R644Q possibly damaging Het
Impg2 A T 16: 56,080,989 (GRCm39) E931V probably damaging Het
Kif5c A T 2: 49,625,497 (GRCm39) Y589F probably benign Het
Krr1 T A 10: 111,813,021 (GRCm39) V132E possibly damaging Het
Luzp1 T G 4: 136,269,764 (GRCm39) D662E probably benign Het
Mc4r A T 18: 66,993,082 (GRCm39) Y10* probably null Het
Mfng T C 15: 78,657,370 (GRCm39) I35V probably benign Het
Mprip T A 11: 59,650,340 (GRCm39) I1348K probably benign Het
Mrgprb3 G T 7: 48,293,255 (GRCm39) Q99K probably benign Het
Mrgprb4 A T 7: 47,848,554 (GRCm39) S125T probably damaging Het
Mrgprg A T 7: 143,318,656 (GRCm39) M152K probably benign Het
Muc5ac A C 7: 141,363,000 (GRCm39) I2104L unknown Het
Myom2 A G 8: 15,182,888 (GRCm39) I1442V probably benign Het
Nell1 T C 7: 49,907,995 (GRCm39) C385R probably damaging Het
Nid2 T G 14: 19,818,346 (GRCm39) V280G probably damaging Het
Npr2 T A 4: 43,643,086 (GRCm39) M490K possibly damaging Het
Prr12 A G 7: 44,684,112 (GRCm39) F1643L probably damaging Het
Psg16 G A 7: 16,827,701 (GRCm39) G128D probably damaging Het
Racgap1 A T 15: 99,520,127 (GRCm39) L595* probably null Het
Rbbp8 T C 18: 11,838,769 (GRCm39) V150A probably benign Het
Rbbp9 T C 2: 144,390,017 (GRCm39) T49A probably benign Het
Rbm20 C A 19: 53,839,930 (GRCm39) T973K possibly damaging Het
Robo1 A T 16: 72,769,420 (GRCm39) I582F possibly damaging Het
Rps6ka5 A T 12: 100,644,791 (GRCm39) V53D possibly damaging Het
Slc35f6 G T 5: 30,813,375 (GRCm39) V156L probably benign Het
Smpd3 T C 8: 106,991,422 (GRCm39) H377R probably benign Het
Son G A 16: 91,453,545 (GRCm39) S764N possibly damaging Het
Srgn A T 10: 62,343,447 (GRCm39) V16D possibly damaging Het
Tex14 G A 11: 87,388,664 (GRCm39) R297Q probably damaging Het
Tiam2 T C 17: 3,557,142 (GRCm39) V1194A probably benign Het
Tlr6 A C 5: 65,111,134 (GRCm39) L591R probably damaging Het
Tmem143 A G 7: 45,558,964 (GRCm39) K302R probably damaging Het
Ttc28 A G 5: 111,371,123 (GRCm39) Y555C probably damaging Het
Usp32 T A 11: 84,968,227 (GRCm39) K145N probably damaging Het
Zbtb40 T C 4: 136,726,878 (GRCm39) Y486C probably damaging Het
Other mutations in Acacb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Acacb APN 5 114,338,350 (GRCm39) missense probably damaging 1.00
IGL01291:Acacb APN 5 114,363,931 (GRCm39) missense probably benign 0.03
IGL01301:Acacb APN 5 114,384,559 (GRCm39) missense probably benign
IGL01633:Acacb APN 5 114,356,919 (GRCm39) splice site probably benign
IGL01736:Acacb APN 5 114,326,503 (GRCm39) missense possibly damaging 0.96
IGL01782:Acacb APN 5 114,338,581 (GRCm39) missense probably damaging 1.00
IGL01924:Acacb APN 5 114,362,047 (GRCm39) splice site probably benign
IGL01933:Acacb APN 5 114,322,251 (GRCm39) splice site probably benign
IGL02028:Acacb APN 5 114,304,076 (GRCm39) missense probably damaging 1.00
IGL02045:Acacb APN 5 114,378,721 (GRCm39) missense possibly damaging 0.95
IGL02346:Acacb APN 5 114,376,760 (GRCm39) missense probably damaging 1.00
IGL02421:Acacb APN 5 114,361,939 (GRCm39) missense probably benign 0.00
IGL02445:Acacb APN 5 114,383,198 (GRCm39) missense probably damaging 1.00
IGL02491:Acacb APN 5 114,330,166 (GRCm39) missense probably damaging 1.00
IGL02598:Acacb APN 5 114,384,098 (GRCm39) missense probably damaging 1.00
IGL02700:Acacb APN 5 114,356,942 (GRCm39) missense probably damaging 1.00
IGL02730:Acacb APN 5 114,304,210 (GRCm39) splice site probably benign
IGL03110:Acacb APN 5 114,333,295 (GRCm39) missense probably damaging 0.96
IGL03125:Acacb APN 5 114,342,866 (GRCm39) missense possibly damaging 0.49
IGL03263:Acacb APN 5 114,351,754 (GRCm39) missense probably damaging 1.00
IGL03324:Acacb APN 5 114,363,915 (GRCm39) nonsense probably null
acetone UTSW 5 114,364,918 (GRCm39) nonsense probably null
anabolism UTSW 5 114,383,281 (GRCm39) missense possibly damaging 0.63
ANU05:Acacb UTSW 5 114,363,931 (GRCm39) missense probably benign 0.03
ANU18:Acacb UTSW 5 114,384,559 (GRCm39) missense probably benign
BB001:Acacb UTSW 5 114,383,281 (GRCm39) missense possibly damaging 0.63
BB011:Acacb UTSW 5 114,383,281 (GRCm39) missense possibly damaging 0.63
I0000:Acacb UTSW 5 114,376,716 (GRCm39) missense probably damaging 0.99
R0001:Acacb UTSW 5 114,342,894 (GRCm39) splice site probably benign
R0219:Acacb UTSW 5 114,371,005 (GRCm39) missense possibly damaging 0.79
R0234:Acacb UTSW 5 114,347,878 (GRCm39) missense probably damaging 0.99
R0234:Acacb UTSW 5 114,347,878 (GRCm39) missense probably damaging 0.99
R0278:Acacb UTSW 5 114,371,320 (GRCm39) nonsense probably null
R0607:Acacb UTSW 5 114,338,362 (GRCm39) missense probably damaging 1.00
R0964:Acacb UTSW 5 114,367,813 (GRCm39) missense possibly damaging 0.64
R1116:Acacb UTSW 5 114,349,017 (GRCm39) missense probably damaging 1.00
R1196:Acacb UTSW 5 114,383,153 (GRCm39) missense probably benign 0.00
R1204:Acacb UTSW 5 114,328,214 (GRCm39) missense probably damaging 1.00
R1387:Acacb UTSW 5 114,338,573 (GRCm39) missense probably benign
R1415:Acacb UTSW 5 114,303,982 (GRCm39) missense probably benign
R1475:Acacb UTSW 5 114,333,313 (GRCm39) missense possibly damaging 0.87
R1497:Acacb UTSW 5 114,334,868 (GRCm39) missense probably damaging 1.00
R1520:Acacb UTSW 5 114,340,001 (GRCm39) missense possibly damaging 0.67
R1591:Acacb UTSW 5 114,341,484 (GRCm39) missense possibly damaging 0.87
R1644:Acacb UTSW 5 114,333,346 (GRCm39) missense probably damaging 1.00
R1732:Acacb UTSW 5 114,328,148 (GRCm39) missense possibly damaging 0.63
R1783:Acacb UTSW 5 114,347,828 (GRCm39) frame shift probably null
R1784:Acacb UTSW 5 114,347,828 (GRCm39) frame shift probably null
R1834:Acacb UTSW 5 114,373,536 (GRCm39) missense probably damaging 1.00
R1858:Acacb UTSW 5 114,334,770 (GRCm39) missense probably benign 0.13
R1886:Acacb UTSW 5 114,357,020 (GRCm39) missense probably damaging 1.00
R1901:Acacb UTSW 5 114,303,795 (GRCm39) nonsense probably null
R1902:Acacb UTSW 5 114,303,795 (GRCm39) nonsense probably null
R1903:Acacb UTSW 5 114,303,795 (GRCm39) nonsense probably null
R1924:Acacb UTSW 5 114,368,781 (GRCm39) missense possibly damaging 0.67
R1934:Acacb UTSW 5 114,336,343 (GRCm39) missense probably benign 0.27
R2051:Acacb UTSW 5 114,383,951 (GRCm39) missense probably damaging 1.00
R2132:Acacb UTSW 5 114,347,828 (GRCm39) frame shift probably null
R2133:Acacb UTSW 5 114,347,828 (GRCm39) frame shift probably null
R2260:Acacb UTSW 5 114,354,978 (GRCm39) missense probably damaging 0.99
R2967:Acacb UTSW 5 114,304,131 (GRCm39) missense possibly damaging 0.81
R3421:Acacb UTSW 5 114,350,697 (GRCm39) splice site probably null
R3729:Acacb UTSW 5 114,345,409 (GRCm39) missense probably damaging 0.99
R4206:Acacb UTSW 5 114,351,712 (GRCm39) missense probably benign
R4245:Acacb UTSW 5 114,368,845 (GRCm39) missense probably damaging 0.97
R4386:Acacb UTSW 5 114,379,982 (GRCm39) critical splice acceptor site probably null
R4439:Acacb UTSW 5 114,384,557 (GRCm39) missense possibly damaging 0.50
R4577:Acacb UTSW 5 114,364,892 (GRCm39) missense probably damaging 1.00
R4658:Acacb UTSW 5 114,338,625 (GRCm39) missense probably damaging 0.96
R4688:Acacb UTSW 5 114,342,824 (GRCm39) missense probably benign 0.01
R4720:Acacb UTSW 5 114,367,975 (GRCm39) missense possibly damaging 0.73
R4898:Acacb UTSW 5 114,370,999 (GRCm39) missense probably benign 0.04
R5044:Acacb UTSW 5 114,304,088 (GRCm39) missense probably benign 0.03
R5070:Acacb UTSW 5 114,384,089 (GRCm39) missense possibly damaging 0.46
R5294:Acacb UTSW 5 114,380,013 (GRCm39) missense probably damaging 1.00
R5350:Acacb UTSW 5 114,382,612 (GRCm39) missense probably damaging 1.00
R5401:Acacb UTSW 5 114,347,914 (GRCm39) missense possibly damaging 0.80
R5531:Acacb UTSW 5 114,342,767 (GRCm39) missense possibly damaging 0.92
R5542:Acacb UTSW 5 114,333,798 (GRCm39) missense probably damaging 1.00
R5751:Acacb UTSW 5 114,368,893 (GRCm39) missense possibly damaging 0.79
R5821:Acacb UTSW 5 114,322,167 (GRCm39) missense possibly damaging 0.69
R5893:Acacb UTSW 5 114,367,912 (GRCm39) missense probably benign 0.01
R5911:Acacb UTSW 5 114,370,951 (GRCm39) missense probably damaging 0.97
R5944:Acacb UTSW 5 114,384,041 (GRCm39) missense probably damaging 1.00
R5973:Acacb UTSW 5 114,364,928 (GRCm39) missense probably damaging 1.00
R6027:Acacb UTSW 5 114,303,661 (GRCm39) missense probably benign 0.43
R6103:Acacb UTSW 5 114,383,942 (GRCm39) missense probably damaging 1.00
R6139:Acacb UTSW 5 114,350,713 (GRCm39) missense probably damaging 1.00
R6292:Acacb UTSW 5 114,338,312 (GRCm39) missense probably damaging 1.00
R6368:Acacb UTSW 5 114,354,884 (GRCm39) missense probably damaging 0.98
R6429:Acacb UTSW 5 114,366,652 (GRCm39) missense probably damaging 1.00
R6942:Acacb UTSW 5 114,330,024 (GRCm39) critical splice donor site probably null
R7138:Acacb UTSW 5 114,345,387 (GRCm39) missense probably benign 0.12
R7241:Acacb UTSW 5 114,383,161 (GRCm39) missense possibly damaging 0.94
R7254:Acacb UTSW 5 114,347,812 (GRCm39) critical splice acceptor site probably null
R7396:Acacb UTSW 5 114,351,722 (GRCm39) missense possibly damaging 0.87
R7439:Acacb UTSW 5 114,333,703 (GRCm39) missense possibly damaging 0.84
R7484:Acacb UTSW 5 114,356,923 (GRCm39) missense probably damaging 1.00
R7585:Acacb UTSW 5 114,384,073 (GRCm39) missense probably damaging 0.99
R7712:Acacb UTSW 5 114,303,799 (GRCm39) missense probably benign 0.13
R7868:Acacb UTSW 5 114,386,288 (GRCm39) missense probably benign 0.22
R7873:Acacb UTSW 5 114,361,339 (GRCm39) missense possibly damaging 0.88
R7924:Acacb UTSW 5 114,383,281 (GRCm39) missense possibly damaging 0.63
R7940:Acacb UTSW 5 114,304,108 (GRCm39) missense possibly damaging 0.77
R7951:Acacb UTSW 5 114,326,401 (GRCm39) missense probably damaging 1.00
R7960:Acacb UTSW 5 114,368,922 (GRCm39) missense probably benign 0.00
R7972:Acacb UTSW 5 114,364,918 (GRCm39) nonsense probably null
R8007:Acacb UTSW 5 114,356,935 (GRCm39) missense probably damaging 0.97
R8022:Acacb UTSW 5 114,361,915 (GRCm39) missense probably benign
R8030:Acacb UTSW 5 114,371,228 (GRCm39) missense probably damaging 1.00
R8241:Acacb UTSW 5 114,333,297 (GRCm39) missense possibly damaging 0.49
R8264:Acacb UTSW 5 114,345,427 (GRCm39) missense probably benign 0.00
R8678:Acacb UTSW 5 114,340,032 (GRCm39) nonsense probably null
R8693:Acacb UTSW 5 114,364,844 (GRCm39) missense probably damaging 0.99
R8697:Acacb UTSW 5 114,351,441 (GRCm39) missense probably damaging 0.96
R8772:Acacb UTSW 5 114,322,179 (GRCm39) missense possibly damaging 0.73
R8918:Acacb UTSW 5 114,333,315 (GRCm39) missense probably damaging 1.00
R9008:Acacb UTSW 5 114,386,815 (GRCm39) splice site silent
R9044:Acacb UTSW 5 114,373,578 (GRCm39) missense probably benign 0.00
R9165:Acacb UTSW 5 114,354,744 (GRCm39) missense probably benign 0.01
R9231:Acacb UTSW 5 114,349,153 (GRCm39) missense probably benign 0.01
R9440:Acacb UTSW 5 114,384,085 (GRCm39) missense possibly damaging 0.56
R9444:Acacb UTSW 5 114,384,020 (GRCm39) missense probably damaging 0.99
R9562:Acacb UTSW 5 114,371,397 (GRCm39) missense probably damaging 0.99
R9794:Acacb UTSW 5 114,387,578 (GRCm39) missense probably benign 0.00
V1662:Acacb UTSW 5 114,376,769 (GRCm39) missense probably damaging 1.00
Z1176:Acacb UTSW 5 114,387,009 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGGCTTTGAAGGAACTGTCC -3'
(R):5'- CAAAAGCCTCATTCTGCCTG -3'

Sequencing Primer
(F):5'- GACCACTGTGGAGTATCTCGTTAAC -3'
(R):5'- GCCTGCCTTCCATGCTG -3'
Posted On 2020-07-28