Incidental Mutation 'R8292:Etv6'
ID 638736
Institutional Source Beutler Lab
Gene Symbol Etv6
Ensembl Gene ENSMUSG00000030199
Gene Name ets variant 6
Synonyms translocation-ets-leukemia, Tel
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_007961.3; MGI: 109336
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R8292 (G1)
Quality Score 225.009
Status Not validated
Chromosome 6
Chromosomal Location 134035700-134270158 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 134248546 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 247 (C247R)
Ref Sequence ENSEMBL: ENSMUSP00000079818 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081028] [ENSMUST00000111963] [ENSMUST00000164648]
AlphaFold P97360
PDB Structure Intramolecular regulation of the ETS Domain within ETV6 sequence R335 to Q436 [SOLUTION NMR]
Intramolecular regulation of the ETS Domain within ETV6 sequence R335 to R458 [SOLUTION NMR]
Structure of uninhibited ETV6 ETS domain [SOLUTION NMR]
Crystal structure of ETV6 bound to a specific DNA sequence [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000081028
AA Change: C247R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000079818
Gene: ENSMUSG00000030199
AA Change: C247R

DomainStartEndE-ValueType
SAM_PNT 39 125 3.49e-41 SMART
ETS 334 420 7.02e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111963
AA Change: C158R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000107594
Gene: ENSMUSG00000030199
AA Change: C158R

DomainStartEndE-ValueType
Pfam:SAM_PNT 1 36 1.3e-10 PFAM
ETS 245 331 7.02e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164648
SMART Domains Protein: ENSMUSP00000130761
Gene: ENSMUSG00000030199

DomainStartEndE-ValueType
SAM_PNT 38 124 3.49e-41 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype Strain: 2177950; 3056143
Lethality: E11-E14
FUNCTION: This gene encodes a transcriptional repressor belonging to the ETS family of proteins. Knockout of this gene in mice results in embryonic lethality due to defective angiogenesis. In humans, this gene is often involved in chromosome rearrangements associated with specific cancers. Alternate splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defective yolk sac angiogenesis, excess apoptosis of mesenchymal and neural cells, and midgestational lethality. [provided by MGI curators]
Allele List at MGI

All alleles(134) : Targeted(7) Gene trapped(127)
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A T 5: 114,200,494 probably null Het
Aim1l T C 4: 134,075,531 S873P probably damaging Het
Akirin2 T C 4: 34,566,007 probably null Het
Akr1c14 A G 13: 4,080,995 D229G possibly damaging Het
Arfgef1 T C 1: 10,156,969 I1382V probably benign Het
Bcas3 C A 11: 85,457,903 A207D probably damaging Het
Bcl2l10 T C 9: 75,347,878 probably benign Het
Cdc42 T C 4: 137,336,073 T3A probably benign Het
Celsr1 C A 15: 85,907,618 W2594L possibly damaging Het
Chrna6 A T 8: 27,406,726 H374Q probably benign Het
Clcnka G A 4: 141,397,961 R30* probably null Het
Clptm1l A T 13: 73,617,735 H464L probably damaging Het
Col6a4 A T 9: 106,076,877 M421K probably benign Het
Dixdc1 A G 9: 50,710,689 V114A probably benign Het
Fam92a T G 4: 12,153,963 T330P possibly damaging Het
Farp2 T C 1: 93,528,628 L11S probably damaging Het
Gbp2 G A 3: 142,623,823 V44M probably damaging Het
Get4 A G 5: 139,262,931 D99G probably null Het
Glcci1 G A 6: 8,558,549 R212H probably damaging Het
Gm14295 T A 2: 176,809,558 F280L probably damaging Het
Gm15800 G A 5: 121,317,225 R644Q possibly damaging Het
Gm5407 T A 16: 49,297,187 N70Y noncoding transcript Het
Hace1 C G 10: 45,711,461 Y885* probably null Het
Impg2 A T 16: 56,260,626 E931V probably damaging Het
Kif5c A T 2: 49,735,485 Y589F probably benign Het
Krr1 T A 10: 111,977,116 V132E possibly damaging Het
Luzp1 T G 4: 136,542,453 D662E probably benign Het
Mc4r A T 18: 66,860,011 Y10* probably null Het
Mfng T C 15: 78,773,170 I35V probably benign Het
Mprip T A 11: 59,759,514 I1348K probably benign Het
Mrgprb3 G T 7: 48,643,507 Q99K probably benign Het
Mrgprb4 A T 7: 48,198,806 S125T probably damaging Het
Mrgprg A T 7: 143,764,919 M152K probably benign Het
Muc5ac A C 7: 141,809,263 I2104L unknown Het
Myom2 A G 8: 15,132,888 I1442V probably benign Het
Nell1 T C 7: 50,258,247 C385R probably damaging Het
Nid2 T G 14: 19,768,278 V280G probably damaging Het
Npr2 T A 4: 43,643,086 M490K possibly damaging Het
Prr12 A G 7: 45,034,688 F1643L probably damaging Het
Psg16 G A 7: 17,093,776 G128D probably damaging Het
Racgap1 A T 15: 99,622,246 L595* probably null Het
Rbbp8 T C 18: 11,705,712 V150A probably benign Het
Rbbp9 T C 2: 144,548,097 T49A probably benign Het
Rbm20 C A 19: 53,851,499 T973K possibly damaging Het
Robo1 A T 16: 72,972,532 I582F possibly damaging Het
Rps6ka5 A T 12: 100,678,532 V53D possibly damaging Het
Slc35f6 G T 5: 30,656,031 V156L probably benign Het
Smpd3 T C 8: 106,264,790 H377R probably benign Het
Son G A 16: 91,656,657 S764N possibly damaging Het
Srgn A T 10: 62,507,668 V16D possibly damaging Het
Tex14 G A 11: 87,497,838 R297Q probably damaging Het
Tiam2 T C 17: 3,506,867 V1194A probably benign Het
Tlr6 A C 5: 64,953,791 L591R probably damaging Het
Tmem143 A G 7: 45,909,540 K302R probably damaging Het
Ttc28 A G 5: 111,223,257 Y555C probably damaging Het
Usp32 T A 11: 85,077,401 K145N probably damaging Het
Zbtb40 T C 4: 136,999,567 Y486C probably damaging Het
Other mutations in Etv6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01636:Etv6 APN 6 134248387 missense probably benign 0.41
IGL02028:Etv6 APN 6 134248733 missense probably benign 0.01
IGL02173:Etv6 APN 6 134248727 missense possibly damaging 0.68
IGL03074:Etv6 APN 6 134222925 missense probably damaging 0.98
R0056:Etv6 UTSW 6 134248534 nonsense probably null
R0295:Etv6 UTSW 6 134266275 missense probably benign 0.31
R2133:Etv6 UTSW 6 134248754 missense possibly damaging 0.92
R3763:Etv6 UTSW 6 134263012 splice site probably benign
R4405:Etv6 UTSW 6 134233534 missense probably damaging 1.00
R6901:Etv6 UTSW 6 134266458 missense probably benign 0.10
R8343:Etv6 UTSW 6 134248754 missense possibly damaging 0.92
R8752:Etv6 UTSW 6 134266428 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTACATCGCCCTAGGTCACC -3'
(R):5'- TGGTTCAAGTAAGCCAGGTC -3'

Sequencing Primer
(F):5'- GCCCTAGGTCACCCATCAC -3'
(R):5'- GTTCAAGTAAGCCAGGTCCTCCC -3'
Posted On 2020-07-28