Incidental Mutation 'R8292:Clptm1l'
ID 638760
Institutional Source Beutler Lab
Gene Symbol Clptm1l
Ensembl Gene ENSMUSG00000021610
Gene Name CLPTM1-like
Synonyms C130052I12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R8292 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 73604006-73620605 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 73617735 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 464 (H464L)
Ref Sequence ENSEMBL: ENSMUSP00000022102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022102]
AlphaFold Q8BXA5
Predicted Effect probably damaging
Transcript: ENSMUST00000022102
AA Change: H464L

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000022102
Gene: ENSMUSG00000021610
AA Change: H464L

DomainStartEndE-ValueType
Pfam:CLPTM1 10 423 3.2e-134 PFAM
transmembrane domain 428 450 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein whose overexpression in cisplatin-sensitive cells causes apoptosis. Polymorphisms in this gene have been reported to increase susceptibility to several cancers, including lung, pancreatic, and breast cancers. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A T 5: 114,200,494 probably null Het
Aim1l T C 4: 134,075,531 S873P probably damaging Het
Akirin2 T C 4: 34,566,007 probably null Het
Akr1c14 A G 13: 4,080,995 D229G possibly damaging Het
Arfgef1 T C 1: 10,156,969 I1382V probably benign Het
Bcas3 C A 11: 85,457,903 A207D probably damaging Het
Bcl2l10 T C 9: 75,347,878 probably benign Het
Cdc42 T C 4: 137,336,073 T3A probably benign Het
Celsr1 C A 15: 85,907,618 W2594L possibly damaging Het
Chrna6 A T 8: 27,406,726 H374Q probably benign Het
Clcnka G A 4: 141,397,961 R30* probably null Het
Col6a4 A T 9: 106,076,877 M421K probably benign Het
Dixdc1 A G 9: 50,710,689 V114A probably benign Het
Etv6 T C 6: 134,248,546 C247R probably benign Het
Fam92a T G 4: 12,153,963 T330P possibly damaging Het
Farp2 T C 1: 93,528,628 L11S probably damaging Het
Gbp2 G A 3: 142,623,823 V44M probably damaging Het
Get4 A G 5: 139,262,931 D99G probably null Het
Glcci1 G A 6: 8,558,549 R212H probably damaging Het
Gm14295 T A 2: 176,809,558 F280L probably damaging Het
Gm15800 G A 5: 121,317,225 R644Q possibly damaging Het
Gm5407 T A 16: 49,297,187 N70Y noncoding transcript Het
Hace1 C G 10: 45,711,461 Y885* probably null Het
Impg2 A T 16: 56,260,626 E931V probably damaging Het
Kif5c A T 2: 49,735,485 Y589F probably benign Het
Krr1 T A 10: 111,977,116 V132E possibly damaging Het
Luzp1 T G 4: 136,542,453 D662E probably benign Het
Mc4r A T 18: 66,860,011 Y10* probably null Het
Mfng T C 15: 78,773,170 I35V probably benign Het
Mprip T A 11: 59,759,514 I1348K probably benign Het
Mrgprb3 G T 7: 48,643,507 Q99K probably benign Het
Mrgprb4 A T 7: 48,198,806 S125T probably damaging Het
Mrgprg A T 7: 143,764,919 M152K probably benign Het
Muc5ac A C 7: 141,809,263 I2104L unknown Het
Myom2 A G 8: 15,132,888 I1442V probably benign Het
Nell1 T C 7: 50,258,247 C385R probably damaging Het
Nid2 T G 14: 19,768,278 V280G probably damaging Het
Npr2 T A 4: 43,643,086 M490K possibly damaging Het
Prr12 A G 7: 45,034,688 F1643L probably damaging Het
Psg16 G A 7: 17,093,776 G128D probably damaging Het
Racgap1 A T 15: 99,622,246 L595* probably null Het
Rbbp8 T C 18: 11,705,712 V150A probably benign Het
Rbbp9 T C 2: 144,548,097 T49A probably benign Het
Rbm20 C A 19: 53,851,499 T973K possibly damaging Het
Robo1 A T 16: 72,972,532 I582F possibly damaging Het
Rps6ka5 A T 12: 100,678,532 V53D possibly damaging Het
Slc35f6 G T 5: 30,656,031 V156L probably benign Het
Smpd3 T C 8: 106,264,790 H377R probably benign Het
Son G A 16: 91,656,657 S764N possibly damaging Het
Srgn A T 10: 62,507,668 V16D possibly damaging Het
Tex14 G A 11: 87,497,838 R297Q probably damaging Het
Tiam2 T C 17: 3,506,867 V1194A probably benign Het
Tlr6 A C 5: 64,953,791 L591R probably damaging Het
Tmem143 A G 7: 45,909,540 K302R probably damaging Het
Ttc28 A G 5: 111,223,257 Y555C probably damaging Het
Usp32 T A 11: 85,077,401 K145N probably damaging Het
Zbtb40 T C 4: 136,999,567 Y486C probably damaging Het
Other mutations in Clptm1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01672:Clptm1l APN 13 73607873 splice site probably null
IGL01963:Clptm1l APN 13 73617569 splice site probably benign
IGL02169:Clptm1l APN 13 73611663 missense probably damaging 0.96
IGL02554:Clptm1l APN 13 73607760 missense probably benign 0.07
IGL02596:Clptm1l APN 13 73613666 missense probably benign 0.02
IGL02720:Clptm1l APN 13 73614602 splice site probably benign
IGL03100:Clptm1l APN 13 73612390 splice site probably benign
P0023:Clptm1l UTSW 13 73604952 missense possibly damaging 0.67
R0308:Clptm1l UTSW 13 73611667 missense possibly damaging 0.67
R0725:Clptm1l UTSW 13 73606343 missense probably benign
R1572:Clptm1l UTSW 13 73607747 missense probably benign
R1589:Clptm1l UTSW 13 73614673 critical splice donor site probably null
R2062:Clptm1l UTSW 13 73607723 nonsense probably null
R2064:Clptm1l UTSW 13 73607723 nonsense probably null
R2065:Clptm1l UTSW 13 73607723 nonsense probably null
R2067:Clptm1l UTSW 13 73607723 nonsense probably null
R2068:Clptm1l UTSW 13 73607723 nonsense probably null
R3003:Clptm1l UTSW 13 73617756 missense possibly damaging 0.51
R3712:Clptm1l UTSW 13 73616038 missense probably benign 0.21
R3808:Clptm1l UTSW 13 73612454 missense probably benign 0.13
R3966:Clptm1l UTSW 13 73615972 missense probably damaging 1.00
R4615:Clptm1l UTSW 13 73607738 nonsense probably null
R4801:Clptm1l UTSW 13 73607862 missense possibly damaging 0.81
R4802:Clptm1l UTSW 13 73607862 missense possibly damaging 0.81
R4957:Clptm1l UTSW 13 73611196 missense possibly damaging 0.52
R4957:Clptm1l UTSW 13 73612428 missense probably damaging 1.00
R5864:Clptm1l UTSW 13 73606284 missense probably damaging 0.99
R6502:Clptm1l UTSW 13 73617765 critical splice donor site probably null
R6701:Clptm1l UTSW 13 73608906 missense probably benign 0.00
R6720:Clptm1l UTSW 13 73618516 missense probably damaging 1.00
R7782:Clptm1l UTSW 13 73604320 missense probably damaging 1.00
R8329:Clptm1l UTSW 13 73612428 missense probably damaging 1.00
R9224:Clptm1l UTSW 13 73604225 start gained probably benign
Predicted Primers PCR Primer
(F):5'- AGGCCAGCAGAGGTCTTTTG -3'
(R):5'- GTGGCTTGTCAGAGTCTAAAATG -3'

Sequencing Primer
(F):5'- CCCCAGCAGAATGTATGTTTG -3'
(R):5'- GGCTTGTCAGAGTCTAAAATGATGTC -3'
Posted On 2020-07-28