Incidental Mutation 'R8292:Rbm20'
ID638772
Institutional Source Beutler Lab
Gene Symbol Rbm20
Ensembl Gene ENSMUSG00000043639
Gene NameRNA binding motif protein 20
Synonyms2010003H22Rik, 1110018J23Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.110) question?
Stock #R8292 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location53677306-53867080 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 53851499 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 973 (T973K)
Ref Sequence ENSEMBL: ENSMUSP00000129447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164202]
Predicted Effect
SMART Domains Protein: ENSMUSP00000124363
Gene: ENSMUSG00000043639
AA Change: T348K

DomainStartEndE-ValueType
low complexity region 10 33 N/A INTRINSIC
low complexity region 180 191 N/A INTRINSIC
low complexity region 209 220 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000164202
AA Change: T973K

PolyPhen 2 Score 0.708 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000129447
Gene: ENSMUSG00000043639
AA Change: T973K

DomainStartEndE-ValueType
low complexity region 25 61 N/A INTRINSIC
low complexity region 106 117 N/A INTRINSIC
low complexity region 170 183 N/A INTRINSIC
low complexity region 251 260 N/A INTRINSIC
ZnF_U1 410 444 6.79e-1 SMART
ZnF_C2H2 413 437 4.69e0 SMART
RRM 521 591 4.01e-5 SMART
low complexity region 634 657 N/A INTRINSIC
low complexity region 804 815 N/A INTRINSIC
low complexity region 833 844 N/A INTRINSIC
ZnF_U1 1130 1165 7.26e-6 SMART
ZnF_C2H2 1133 1158 3.13e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that binds RNA and regulates splicing. Mutations in this gene have been associated with familial dilated cardiomyopathy. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for an allele lacking the RNA recognition motif exhibit increased titin compliance, and attenuated Frank-Starling mechanism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A T 5: 114,200,494 probably null Het
Aim1l T C 4: 134,075,531 S873P probably damaging Het
Akirin2 T C 4: 34,566,007 probably null Het
Akr1c14 A G 13: 4,080,995 D229G possibly damaging Het
Arfgef1 T C 1: 10,156,969 I1382V probably benign Het
Bcas3 C A 11: 85,457,903 A207D probably damaging Het
Bcl2l10 T C 9: 75,347,878 probably benign Het
Cdc42 T C 4: 137,336,073 T3A probably benign Het
Celsr1 C A 15: 85,907,618 W2594L possibly damaging Het
Chrna6 A T 8: 27,406,726 H374Q probably benign Het
Clcnka G A 4: 141,397,961 R30* probably null Het
Clptm1l A T 13: 73,617,735 H464L probably damaging Het
Col6a4 A T 9: 106,076,877 M421K probably benign Het
Dixdc1 A G 9: 50,710,689 V114A probably benign Het
Etv6 T C 6: 134,248,546 C247R probably benign Het
Fam92a T G 4: 12,153,963 T330P possibly damaging Het
Farp2 T C 1: 93,528,628 L11S probably damaging Het
Gbp2 G A 3: 142,623,823 V44M probably damaging Het
Get4 A G 5: 139,262,931 D99G probably null Het
Glcci1 G A 6: 8,558,549 R212H probably damaging Het
Gm14295 T A 2: 176,809,558 F280L probably damaging Het
Gm15800 G A 5: 121,317,225 R644Q possibly damaging Het
Gm5407 T A 16: 49,297,187 N70Y noncoding transcript Het
Hace1 C G 10: 45,711,461 Y885* probably null Het
Impg2 A T 16: 56,260,626 E931V probably damaging Het
Kif5c A T 2: 49,735,485 Y589F probably benign Het
Krr1 T A 10: 111,977,116 V132E possibly damaging Het
Luzp1 T G 4: 136,542,453 D662E probably benign Het
Mc4r A T 18: 66,860,011 Y10* probably null Het
Mfng T C 15: 78,773,170 I35V probably benign Het
Mprip T A 11: 59,759,514 I1348K probably benign Het
Mrgprb3 G T 7: 48,643,507 Q99K probably benign Het
Mrgprb4 A T 7: 48,198,806 S125T probably damaging Het
Mrgprg A T 7: 143,764,919 M152K probably benign Het
Muc5ac A C 7: 141,809,263 I2104L unknown Het
Myom2 A G 8: 15,132,888 I1442V probably benign Het
Nell1 T C 7: 50,258,247 C385R probably damaging Het
Nid2 T G 14: 19,768,278 V280G probably damaging Het
Npr2 T A 4: 43,643,086 M490K possibly damaging Het
Prr12 A G 7: 45,034,688 F1643L probably damaging Het
Psg16 G A 7: 17,093,776 G128D probably damaging Het
Racgap1 A T 15: 99,622,246 L595* probably null Het
Rbbp8 T C 18: 11,705,712 V150A probably benign Het
Rbbp9 T C 2: 144,548,097 T49A probably benign Het
Robo1 A T 16: 72,972,532 I582F possibly damaging Het
Rps6ka5 A T 12: 100,678,532 V53D possibly damaging Het
Slc35f6 G T 5: 30,656,031 V156L probably benign Het
Smpd3 T C 8: 106,264,790 H377R probably benign Het
Son G A 16: 91,656,657 S764N possibly damaging Het
Srgn A T 10: 62,507,668 V16D possibly damaging Het
Tex14 G A 11: 87,497,838 R297Q probably damaging Het
Tiam2 T C 17: 3,506,867 V1194A probably benign Het
Tlr6 A C 5: 64,953,791 L591R probably damaging Het
Tmem143 A G 7: 45,909,540 K302R probably damaging Het
Ttc28 A G 5: 111,223,257 Y555C probably damaging Het
Usp32 T A 11: 85,077,401 K145N probably damaging Het
Zbtb40 T C 4: 136,999,567 Y486C probably damaging Het
Other mutations in Rbm20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Rbm20 APN 19 53843264 missense probably damaging 1.00
IGL00815:Rbm20 APN 19 53815517 missense probably damaging 1.00
IGL00845:Rbm20 APN 19 53817949 missense probably damaging 1.00
IGL01408:Rbm20 APN 19 53851613 missense possibly damaging 0.95
IGL01663:Rbm20 APN 19 53840995 missense probably damaging 1.00
IGL01902:Rbm20 APN 19 53840991 missense probably damaging 0.99
IGL01942:Rbm20 APN 19 53813443 missense probably damaging 1.00
IGL02964:Rbm20 APN 19 53813702 missense probably benign 0.02
IGL03326:Rbm20 APN 19 53814000 missense possibly damaging 0.85
BB001:Rbm20 UTSW 19 53677585 missense possibly damaging 0.63
BB002:Rbm20 UTSW 19 53813322 missense probably damaging 0.97
BB011:Rbm20 UTSW 19 53677585 missense possibly damaging 0.63
BB012:Rbm20 UTSW 19 53813322 missense probably damaging 0.97
R0326:Rbm20 UTSW 19 53864165 missense probably damaging 1.00
R0487:Rbm20 UTSW 19 53851195 missense probably damaging 1.00
R0965:Rbm20 UTSW 19 53859401 missense probably damaging 1.00
R1435:Rbm20 UTSW 19 53814157 missense probably benign 0.16
R1914:Rbm20 UTSW 19 53864087 missense probably damaging 1.00
R1915:Rbm20 UTSW 19 53864087 missense probably damaging 1.00
R2011:Rbm20 UTSW 19 53859428 missense probably damaging 1.00
R2012:Rbm20 UTSW 19 53859428 missense probably damaging 1.00
R2258:Rbm20 UTSW 19 53851741 missense probably benign
R3947:Rbm20 UTSW 19 53813337 missense probably benign 0.35
R4305:Rbm20 UTSW 19 53843260 missense probably damaging 1.00
R4308:Rbm20 UTSW 19 53843260 missense probably damaging 1.00
R4521:Rbm20 UTSW 19 53817202 missense probably benign 0.14
R4970:Rbm20 UTSW 19 53851669 missense probably damaging 0.99
R5266:Rbm20 UTSW 19 53813387 missense probably damaging 1.00
R5475:Rbm20 UTSW 19 53834705 nonsense probably null
R5503:Rbm20 UTSW 19 53851354 missense possibly damaging 0.75
R5995:Rbm20 UTSW 19 53851267 missense possibly damaging 0.95
R6836:Rbm20 UTSW 19 53814069 missense probably damaging 0.98
R6947:Rbm20 UTSW 19 53851265 missense probably damaging 1.00
R7030:Rbm20 UTSW 19 53834766 missense probably damaging 1.00
R7117:Rbm20 UTSW 19 53851558 missense possibly damaging 0.92
R7237:Rbm20 UTSW 19 53851499 missense probably benign 0.04
R7638:Rbm20 UTSW 19 53814333 missense possibly damaging 0.95
R7792:Rbm20 UTSW 19 53850136 missense probably benign
R7823:Rbm20 UTSW 19 53843354 missense probably benign 0.33
R7924:Rbm20 UTSW 19 53677585 missense possibly damaging 0.63
R7925:Rbm20 UTSW 19 53813322 missense probably damaging 0.97
R8044:Rbm20 UTSW 19 53817971 missense probably benign 0.44
R8045:Rbm20 UTSW 19 53817971 missense probably benign 0.44
R8046:Rbm20 UTSW 19 53817971 missense probably benign 0.44
R8100:Rbm20 UTSW 19 53851313 missense possibly damaging 0.85
R8366:Rbm20 UTSW 19 53850181 missense possibly damaging 0.95
R8518:Rbm20 UTSW 19 53851492 missense probably benign 0.18
RF016:Rbm20 UTSW 19 53813732 missense probably benign 0.00
Z1177:Rbm20 UTSW 19 53851685 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGTGCCTATTGACCAGAAAGAC -3'
(R):5'- CCTTGCAGTCATCGAGAAAAGG -3'

Sequencing Primer
(F):5'- GTGCCTATTGACCAGAAAGACAAAAC -3'
(R):5'- TCATCGAGAAAAGGGCTGGACTG -3'
Posted On2020-07-28