Incidental Mutation 'R8293:Tank'
ID638777
Institutional Source Beutler Lab
Gene Symbol Tank
Ensembl Gene ENSMUSG00000064289
Gene NameTRAF family member-associated Nf-kappa B activator
SynonymsE430026L09Rik, I-TRAF
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.772) question?
Stock #R8293 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location61578585-61654171 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 61644414 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 204 (I204N)
Ref Sequence ENSEMBL: ENSMUSP00000077219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078074] [ENSMUST00000112494] [ENSMUST00000112495] [ENSMUST00000112501] [ENSMUST00000112502]
Predicted Effect possibly damaging
Transcript: ENSMUST00000078074
AA Change: I204N

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000077219
Gene: ENSMUSG00000064289
AA Change: I204N

DomainStartEndE-ValueType
coiled coil region 60 98 N/A INTRINSIC
Pfam:TBD 165 219 1.2e-27 PFAM
ZnF_C2H2 417 443 1.81e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112494
AA Change: I169N

PolyPhen 2 Score 0.213 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000108113
Gene: ENSMUSG00000064289
AA Change: I169N

DomainStartEndE-ValueType
coiled coil region 22 63 N/A INTRINSIC
Pfam:TBD 128 184 5.9e-34 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000112495
AA Change: I169N

PolyPhen 2 Score 0.462 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000108114
Gene: ENSMUSG00000064289
AA Change: I169N

DomainStartEndE-ValueType
coiled coil region 22 63 N/A INTRINSIC
Pfam:TBD 128 184 1.3e-33 PFAM
ZnF_C2H2 382 408 1.81e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112501
AA Change: I170N

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000108120
Gene: ENSMUSG00000064289
AA Change: I170N

DomainStartEndE-ValueType
coiled coil region 26 64 N/A INTRINSIC
Pfam:TBD 129 185 1.3e-33 PFAM
ZnF_C2H2 383 409 1.81e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000112502
AA Change: I203N

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000108121
Gene: ENSMUSG00000064289
AA Change: I203N

DomainStartEndE-ValueType
coiled coil region 56 97 N/A INTRINSIC
Pfam:TBD 162 218 8.2e-34 PFAM
ZnF_C2H2 416 442 1.81e1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The TRAF (tumor necrosis factor receptor-associated factor) family of proteins associate with and transduce signals from members of the tumor necrosis factor receptor superfamily. The protein encoded by this gene is found in the cytoplasm and can bind to TRAF1, TRAF2, or TRAF3, thereby inhibiting TRAF function by sequestering the TRAFs in a latent state in the cytoplasm. For example, the protein encoded by this gene can block TRAF2 binding to LMP1, the Epstein-Barr virus transforming protein, and inhibit LMP1-mediated NF-kappa-B activation. Three alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous null mice develop fatal glomerulonephritis owing to deposition of immune complexes. Dendritic cells, macrophages and B cells from these mice are hyper-responsive to stimuli leading to increased production of immunoglobulins and inflammatory cytokines. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,226,002 S105P possibly damaging Het
4930539E08Rik T C 17: 28,902,890 K468E probably benign Het
A430105I19Rik T A 2: 118,761,315 T115S probably damaging Het
Acsm1 T G 7: 119,638,096 S211A possibly damaging Het
Adam4 T A 12: 81,420,411 R479* probably null Het
Agap3 A C 5: 24,487,885 S439R probably damaging Het
Arap1 A T 7: 101,400,934 H1075L probably benign Het
Arhgef28 T C 13: 97,942,521 E1299G probably benign Het
Cc2d2a A T 5: 43,688,228 I329F probably damaging Het
Cd200r1 A G 16: 44,789,721 N101S probably benign Het
Cfap221 A G 1: 119,981,774 V156A possibly damaging Het
Chrm4 C T 2: 91,928,218 P324S probably benign Het
Chrna1 T A 2: 73,570,506 M227L probably benign Het
Cntln A G 4: 85,033,838 D639G probably damaging Het
Cts8 A G 13: 61,254,068 V5A probably benign Het
Cxcl2 A T 5: 90,904,229 T65S probably damaging Het
Cyp2c39 G T 19: 39,563,967 R368L probably benign Het
D630023F18Rik A T 1: 65,108,780 S205T probably benign Het
Dagla A T 19: 10,252,037 probably null Het
Dtnbp1 G A 13: 44,931,139 T175I probably benign Het
Dtx3 A G 10: 127,191,013 L332P probably damaging Het
E2f4 A G 8: 105,297,819 T27A probably damaging Het
Ep400 A G 5: 110,708,892 F1163L unknown Het
Fam83h ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT 15: 76,002,775 probably benign Het
Fbxo40 T C 16: 36,970,025 D241G probably benign Het
Fus T C 7: 127,972,577 S184P unknown Het
Gabarap C A 11: 69,992,672 T87N possibly damaging Het
Gbp10 A C 5: 105,224,369 V175G probably damaging Het
Gcm2 A G 13: 41,103,170 Y368H probably damaging Het
Heca A G 10: 17,902,263 Y529H probably damaging Het
Incenp G A 19: 9,875,133 R714* probably null Het
Lvrn C A 18: 46,850,565 T125K possibly damaging Het
Ms4a6c T A 19: 11,478,296 S156R probably benign Het
Nab2 C A 10: 127,666,397 R21L possibly damaging Het
Neb A T 2: 52,246,815 M3218K probably benign Het
Nwd2 A G 5: 63,805,320 D749G probably benign Het
Nxpe5 A T 5: 138,230,542 Q7L probably benign Het
Olfr1318 A T 2: 112,156,253 M101L probably benign Het
Olfr1335 T A 4: 118,809,742 T41S probably benign Het
Olfr481 A T 7: 108,081,062 E89D probably benign Het
Olfr943 A G 9: 39,184,393 I72V possibly damaging Het
Pla2g5 A G 4: 138,804,606 I29T probably damaging Het
Prpf31 C T 7: 3,640,918 T499I probably damaging Het
Rnf130 T A 11: 50,095,796 D322E probably benign Het
Ros1 T C 10: 52,087,918 N1770D probably damaging Het
Sacs T A 14: 61,191,099 D202E probably damaging Het
Simc1 A G 13: 54,526,546 I902M probably damaging Het
Slc12a8 A T 16: 33,540,978 M77L probably benign Het
Slc35f2 G A 9: 53,816,940 G366D probably benign Het
Slc44a2 A G 9: 21,353,688 D674G probably damaging Het
Stip1 T C 19: 7,034,250 N139S probably benign Het
Taar8c C T 10: 24,101,117 V266M probably benign Het
Tcerg1 A G 18: 42,560,955 T714A probably benign Het
Tenm3 A T 8: 48,367,422 F334I possibly damaging Het
Ubr1 T C 2: 120,862,721 I1735V probably benign Het
Vps13a A T 19: 16,668,605 S2023T possibly damaging Het
Wdfy4 T C 14: 32,974,261 H2741R Het
Wnt10a G T 1: 74,803,217 R284L probably damaging Het
Other mutations in Tank
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02994:Tank APN 2 61650292 splice site probably benign
malade UTSW 2 61644424 critical splice donor site probably null
R1620:Tank UTSW 2 61650098 missense possibly damaging 0.92
R1671:Tank UTSW 2 61649753 missense probably damaging 0.99
R1862:Tank UTSW 2 61649912 missense probably damaging 1.00
R3918:Tank UTSW 2 61643786 critical splice donor site probably null
R4714:Tank UTSW 2 61650229 missense probably benign 0.01
R4727:Tank UTSW 2 61653532 missense probably benign 0.05
R4865:Tank UTSW 2 61578635 start gained probably benign
R4867:Tank UTSW 2 61578635 start gained probably benign
R5023:Tank UTSW 2 61578635 start gained probably benign
R5213:Tank UTSW 2 61649948 missense probably benign 0.01
R5562:Tank UTSW 2 61650208 missense possibly damaging 0.59
R5950:Tank UTSW 2 61653569 utr 3 prime probably benign
R6221:Tank UTSW 2 61650083 missense probably damaging 1.00
R6626:Tank UTSW 2 61650296 splice site probably benign
R6670:Tank UTSW 2 61644424 critical splice donor site probably null
R6850:Tank UTSW 2 61650002 missense probably benign 0.19
R7027:Tank UTSW 2 61653422 missense probably benign 0.00
R7478:Tank UTSW 2 61650169 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCTGTGGTCCATAAAAGCTATGC -3'
(R):5'- GGCAAGGTACAGATTCTTAGCCTTTC -3'

Sequencing Primer
(F):5'- AATATAGAGAAGACTTTCTGGG -3'
(R):5'- GGTACAGATTCTTAGCCTTTCATAAC -3'
Posted On2020-07-28