Incidental Mutation 'R8293:Cntln'
ID 638783
Institutional Source Beutler Lab
Gene Symbol Cntln
Ensembl Gene ENSMUSG00000038070
Gene Name centlein, centrosomal protein
Synonyms D530005L17Rik, B430108F07Rik
MMRRC Submission 067783-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.340) question?
Stock # R8293 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 84802546-85050158 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 84952075 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 639 (D639G)
Ref Sequence ENSEMBL: ENSMUSP00000044138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047023] [ENSMUST00000169371]
AlphaFold A2AM05
Predicted Effect probably damaging
Transcript: ENSMUST00000047023
AA Change: D639G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044138
Gene: ENSMUSG00000038070
AA Change: D639G

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
internal_repeat_1 198 219 1.25e-5 PROSPERO
low complexity region 242 251 N/A INTRINSIC
internal_repeat_1 321 342 1.25e-5 PROSPERO
low complexity region 346 358 N/A INTRINSIC
coiled coil region 404 433 N/A INTRINSIC
low complexity region 434 446 N/A INTRINSIC
coiled coil region 458 481 N/A INTRINSIC
coiled coil region 516 584 N/A INTRINSIC
coiled coil region 606 648 N/A INTRINSIC
coiled coil region 674 780 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 973 1114 N/A INTRINSIC
low complexity region 1206 1217 N/A INTRINSIC
Blast:HisKA 1270 1326 1e-24 BLAST
low complexity region 1327 1348 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169371
AA Change: D639G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130491
Gene: ENSMUSG00000038070
AA Change: D639G

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
internal_repeat_1 198 219 1.24e-5 PROSPERO
low complexity region 242 251 N/A INTRINSIC
internal_repeat_1 321 342 1.24e-5 PROSPERO
low complexity region 346 358 N/A INTRINSIC
coiled coil region 404 433 N/A INTRINSIC
low complexity region 434 446 N/A INTRINSIC
coiled coil region 458 481 N/A INTRINSIC
coiled coil region 516 584 N/A INTRINSIC
coiled coil region 606 648 N/A INTRINSIC
coiled coil region 674 780 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 972 1113 N/A INTRINSIC
low complexity region 1205 1216 N/A INTRINSIC
Blast:HisKA 1269 1325 1e-24 BLAST
low complexity region 1326 1347 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,061,864 (GRCm39) S105P possibly damaging Het
Acsm1 T G 7: 119,237,319 (GRCm39) S211A possibly damaging Het
Adam4 T A 12: 81,467,185 (GRCm39) R479* probably null Het
Agap3 A C 5: 24,692,883 (GRCm39) S439R probably damaging Het
Arap1 A T 7: 101,050,141 (GRCm39) H1075L probably benign Het
Arhgef28 T C 13: 98,079,029 (GRCm39) E1299G probably benign Het
Bnip5 T C 17: 29,121,864 (GRCm39) K468E probably benign Het
Cc2d2a A T 5: 43,845,570 (GRCm39) I329F probably damaging Het
Ccdc9b T A 2: 118,591,796 (GRCm39) T115S probably damaging Het
Cd200r1 A G 16: 44,610,084 (GRCm39) N101S probably benign Het
Ces2b A C 8: 105,559,258 (GRCm39) T40P unknown Het
Cfap221 A G 1: 119,909,504 (GRCm39) V156A possibly damaging Het
Chrm4 C T 2: 91,758,563 (GRCm39) P324S probably benign Het
Chrna1 T A 2: 73,400,850 (GRCm39) M227L probably benign Het
Cts8 A G 13: 61,401,882 (GRCm39) V5A probably benign Het
Cxcl2 A T 5: 91,052,088 (GRCm39) T65S probably damaging Het
Cyp2c39 G T 19: 39,552,411 (GRCm39) R368L probably benign Het
D630023F18Rik A T 1: 65,147,939 (GRCm39) S205T probably benign Het
Dagla A T 19: 10,229,401 (GRCm39) probably null Het
Dtnbp1 G A 13: 45,084,615 (GRCm39) T175I probably benign Het
Dtx3 A G 10: 127,026,882 (GRCm39) L332P probably damaging Het
E2f4 A G 8: 106,024,451 (GRCm39) T27A probably damaging Het
Ep400 A G 5: 110,856,758 (GRCm39) F1163L unknown Het
Fam83h ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT 15: 75,874,624 (GRCm39) probably benign Het
Fbxo40 T C 16: 36,790,387 (GRCm39) D241G probably benign Het
Fus T C 7: 127,571,749 (GRCm39) S184P unknown Het
Gabarap C A 11: 69,883,498 (GRCm39) T87N possibly damaging Het
Gbp10 A C 5: 105,372,235 (GRCm39) V175G probably damaging Het
Gcm2 A G 13: 41,256,646 (GRCm39) Y368H probably damaging Het
Heca A G 10: 17,778,011 (GRCm39) Y529H probably damaging Het
Incenp G A 19: 9,852,497 (GRCm39) R714* probably null Het
Lvrn C A 18: 46,983,632 (GRCm39) T125K possibly damaging Het
Ms4a6c T A 19: 11,455,660 (GRCm39) S156R probably benign Het
Nab2 C A 10: 127,502,266 (GRCm39) R21L possibly damaging Het
Neb A T 2: 52,136,827 (GRCm39) M3218K probably benign Het
Nwd2 A G 5: 63,962,663 (GRCm39) D749G probably benign Het
Nxpe5 A T 5: 138,228,804 (GRCm39) Q7L probably benign Het
Or10ak12 T A 4: 118,666,939 (GRCm39) T41S probably benign Het
Or4f62 A T 2: 111,986,598 (GRCm39) M101L probably benign Het
Or5p4 A T 7: 107,680,269 (GRCm39) E89D probably benign Het
Or8g26 A G 9: 39,095,689 (GRCm39) I72V possibly damaging Het
Pla2g5 A G 4: 138,531,917 (GRCm39) I29T probably damaging Het
Prpf31 C T 7: 3,643,917 (GRCm39) T499I probably damaging Het
Rnf130 T A 11: 49,986,623 (GRCm39) D322E probably benign Het
Ros1 T C 10: 51,964,014 (GRCm39) N1770D probably damaging Het
Sacs T A 14: 61,428,548 (GRCm39) D202E probably damaging Het
Simc1 A G 13: 54,674,359 (GRCm39) I902M probably damaging Het
Slc12a8 A T 16: 33,361,348 (GRCm39) M77L probably benign Het
Slc35f2 G A 9: 53,724,224 (GRCm39) G366D probably benign Het
Slc44a2 A G 9: 21,264,984 (GRCm39) D674G probably damaging Het
Smok2a A C 17: 13,445,791 (GRCm39) E456A probably benign Het
Stip1 T C 19: 7,011,618 (GRCm39) N139S probably benign Het
Taar8c C T 10: 23,977,015 (GRCm39) V266M probably benign Het
Tank T A 2: 61,474,758 (GRCm39) I204N possibly damaging Het
Tcerg1 A G 18: 42,694,020 (GRCm39) T714A probably benign Het
Tenm3 A T 8: 48,820,457 (GRCm39) F334I possibly damaging Het
Ubr1 T C 2: 120,693,202 (GRCm39) I1735V probably benign Het
Vps13a A T 19: 16,645,969 (GRCm39) S2023T possibly damaging Het
Wdfy4 T C 14: 32,696,218 (GRCm39) H2741R Het
Wnt10a G T 1: 74,842,376 (GRCm39) R284L probably damaging Het
Other mutations in Cntln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Cntln APN 4 84,924,671 (GRCm39) missense probably benign 0.25
IGL00743:Cntln APN 4 84,897,652 (GRCm39) missense probably benign 0.06
IGL01014:Cntln APN 4 84,968,145 (GRCm39) missense probably benign 0.25
IGL02217:Cntln APN 4 85,018,495 (GRCm39) missense probably damaging 1.00
IGL02323:Cntln APN 4 84,968,026 (GRCm39) missense probably benign 0.00
IGL02353:Cntln APN 4 84,968,087 (GRCm39) missense probably damaging 0.98
IGL02360:Cntln APN 4 84,968,087 (GRCm39) missense probably damaging 0.98
IGL02616:Cntln APN 4 85,033,689 (GRCm39) critical splice donor site probably null
PIT4696001:Cntln UTSW 4 84,892,237 (GRCm39) missense probably damaging 0.99
R0110:Cntln UTSW 4 85,014,994 (GRCm39) missense probably damaging 1.00
R0324:Cntln UTSW 4 85,010,932 (GRCm39) missense probably damaging 0.98
R0349:Cntln UTSW 4 84,914,722 (GRCm39) missense probably damaging 1.00
R0519:Cntln UTSW 4 84,923,290 (GRCm39) splice site probably benign
R0529:Cntln UTSW 4 84,986,062 (GRCm39) missense probably damaging 1.00
R0582:Cntln UTSW 4 84,802,978 (GRCm39) missense probably damaging 1.00
R1077:Cntln UTSW 4 84,914,716 (GRCm39) missense probably damaging 1.00
R1345:Cntln UTSW 4 84,892,228 (GRCm39) missense probably damaging 1.00
R1457:Cntln UTSW 4 85,015,076 (GRCm39) missense probably benign 0.33
R1571:Cntln UTSW 4 84,865,823 (GRCm39) nonsense probably null
R1622:Cntln UTSW 4 84,981,418 (GRCm39) missense probably damaging 1.00
R1681:Cntln UTSW 4 84,865,872 (GRCm39) missense probably damaging 1.00
R1777:Cntln UTSW 4 85,048,916 (GRCm39) missense probably benign 0.23
R1808:Cntln UTSW 4 85,015,000 (GRCm39) missense probably damaging 1.00
R1882:Cntln UTSW 4 85,019,072 (GRCm39) missense probably damaging 1.00
R2056:Cntln UTSW 4 84,967,911 (GRCm39) missense probably benign
R2965:Cntln UTSW 4 84,892,264 (GRCm39) critical splice donor site probably null
R2968:Cntln UTSW 4 84,875,504 (GRCm39) missense probably benign 0.27
R3104:Cntln UTSW 4 84,875,406 (GRCm39) missense possibly damaging 0.95
R3106:Cntln UTSW 4 84,875,406 (GRCm39) missense possibly damaging 0.95
R3121:Cntln UTSW 4 84,923,289 (GRCm39) splice site probably benign
R3617:Cntln UTSW 4 84,923,214 (GRCm39) nonsense probably null
R4009:Cntln UTSW 4 84,981,452 (GRCm39) missense probably benign 0.45
R4036:Cntln UTSW 4 84,924,725 (GRCm39) missense probably damaging 1.00
R4548:Cntln UTSW 4 85,015,079 (GRCm39) missense probably benign 0.27
R4592:Cntln UTSW 4 84,889,419 (GRCm39) missense probably benign 0.00
R4666:Cntln UTSW 4 84,889,453 (GRCm39) missense probably benign 0.13
R4826:Cntln UTSW 4 84,923,281 (GRCm39) missense probably benign 0.03
R4836:Cntln UTSW 4 84,967,957 (GRCm39) nonsense probably null
R4856:Cntln UTSW 4 84,889,466 (GRCm39) missense probably benign 0.35
R4886:Cntln UTSW 4 84,889,466 (GRCm39) missense probably benign 0.35
R4995:Cntln UTSW 4 84,968,120 (GRCm39) missense probably benign 0.00
R5090:Cntln UTSW 4 84,865,830 (GRCm39) missense probably damaging 0.98
R5202:Cntln UTSW 4 84,889,466 (GRCm39) missense probably benign 0.35
R5905:Cntln UTSW 4 84,889,410 (GRCm39) missense probably benign 0.03
R5953:Cntln UTSW 4 84,968,156 (GRCm39) missense possibly damaging 0.92
R6028:Cntln UTSW 4 84,889,410 (GRCm39) missense probably benign 0.03
R6298:Cntln UTSW 4 85,014,998 (GRCm39) missense probably damaging 1.00
R6351:Cntln UTSW 4 85,033,591 (GRCm39) missense probably damaging 0.99
R6371:Cntln UTSW 4 84,802,816 (GRCm39) missense probably damaging 0.98
R6481:Cntln UTSW 4 84,985,747 (GRCm39) missense probably benign 0.00
R6864:Cntln UTSW 4 85,015,029 (GRCm39) missense probably damaging 0.99
R6874:Cntln UTSW 4 84,985,996 (GRCm39) missense probably damaging 1.00
R6919:Cntln UTSW 4 85,033,605 (GRCm39) missense probably benign 0.04
R7071:Cntln UTSW 4 85,018,622 (GRCm39) missense probably damaging 1.00
R7113:Cntln UTSW 4 84,968,064 (GRCm39) missense probably damaging 0.98
R7152:Cntln UTSW 4 84,802,937 (GRCm39) missense possibly damaging 0.87
R7253:Cntln UTSW 4 85,036,710 (GRCm39) missense probably damaging 1.00
R7289:Cntln UTSW 4 84,964,540 (GRCm39) missense possibly damaging 0.80
R7440:Cntln UTSW 4 84,981,453 (GRCm39) missense possibly damaging 0.95
R7670:Cntln UTSW 4 84,897,577 (GRCm39) missense possibly damaging 0.66
R7707:Cntln UTSW 4 84,802,853 (GRCm39) missense probably damaging 1.00
R7895:Cntln UTSW 4 84,981,561 (GRCm39) missense possibly damaging 0.91
R8176:Cntln UTSW 4 84,806,926 (GRCm39) missense probably damaging 0.99
R8247:Cntln UTSW 4 85,019,017 (GRCm39) missense probably benign 0.39
R8264:Cntln UTSW 4 85,016,648 (GRCm39) missense probably damaging 1.00
R8536:Cntln UTSW 4 84,875,286 (GRCm39) missense probably damaging 1.00
R8844:Cntln UTSW 4 84,892,234 (GRCm39) missense probably damaging 1.00
R8924:Cntln UTSW 4 84,806,936 (GRCm39) missense probably damaging 1.00
R8955:Cntln UTSW 4 84,986,110 (GRCm39) missense possibly damaging 0.85
R8960:Cntln UTSW 4 85,018,961 (GRCm39) missense possibly damaging 0.59
R8979:Cntln UTSW 4 85,048,910 (GRCm39) missense probably damaging 1.00
R9255:Cntln UTSW 4 85,019,103 (GRCm39) missense possibly damaging 0.93
R9314:Cntln UTSW 4 84,924,719 (GRCm39) missense probably damaging 1.00
R9353:Cntln UTSW 4 84,802,597 (GRCm39) unclassified probably benign
R9361:Cntln UTSW 4 84,968,151 (GRCm39) missense probably benign 0.23
R9376:Cntln UTSW 4 84,875,258 (GRCm39) missense probably benign 0.24
R9382:Cntln UTSW 4 84,968,318 (GRCm39) missense probably benign 0.13
R9471:Cntln UTSW 4 84,968,019 (GRCm39) missense possibly damaging 0.62
R9478:Cntln UTSW 4 84,897,630 (GRCm39) missense probably benign 0.00
R9527:Cntln UTSW 4 84,892,120 (GRCm39) missense probably damaging 1.00
R9788:Cntln UTSW 4 84,968,093 (GRCm39) missense probably damaging 1.00
R9793:Cntln UTSW 4 84,985,798 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCATTTGTTACAGTGCAGTTGATAG -3'
(R):5'- CTCAAAGTGGGATGTTTAGGAGTTC -3'

Sequencing Primer
(F):5'- ACAGTGCAGTTGATAGTTTGTAC -3'
(R):5'- GTTGCATTTCATTTTCTCATGAGAC -3'
Posted On 2020-07-28