Mutagenetix > Incidental Mutation

Incidental Mutation 'R0713:Cd177'

63879

Institutional Source

Beutler Lab

Gene Symbol

Cd177

Ensembl Gene

ENSMUSG00000052212

Gene Name

CD177 antigen

Synonyms

1190003K14Rik, Pdp3

MMRRC Submission

038896-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.507) question?

Stock #

R0713 (G1)

Quality Score

133

Status

Not validated

Chromosome

Chromosomal Location

24443408-24459736 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 24443855 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 748 (I748V)

Ref Sequence

ENSEMBL: ENSMUSP00000064934 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000063956]

AlphaFold

Q8R2S8

Predicted Effect

probably benign
Transcript: ENSMUST00000063956
AA Change: I748V

PolyPhen 2 Score 0.254 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000064934
Gene: ENSMUSG00000052212
AA Change: I748V

Domain	Start	End	E-Value	Type
Pfam:UPAR_LY6	134	214	3.7e-11	PFAM
Pfam:UPAR_LY6	226	300	1.2e-4	PFAM
low complexity region	301	317	N/A	INTRINSIC
Pfam:UPAR_LY6	322	400	1.5e-9	PFAM
Pfam:UPAR_LY6	511	586	9.1e-12	PFAM
Pfam:UPAR_LY6	705	782	1.4e-11	PFAM
low complexity region	795	811	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206160

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosyl-phosphatidylinositol (GPI)-linked cell surface glycoprotein that plays a role in neutrophil activation. The protein can bind platelet endothelial cell adhesion molecule-1 and function in neutrophil transmigration. Mutations in this gene are associated with myeloproliferative diseases. Over-expression of this gene has been found in patients with polycythemia rubra vera. Autoantibodies against the protein may result in pulmonary transfusion reactions, and it may be involved in Wegener's granulomatosis. A related pseudogene, which is adjacent to this gene on chromosome 19, has been identified. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased circulating neutrophils, increased neutrophil cell death and decreased neutrophils and monocytes early after S. aureus infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 6 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Dst	C	T	1: 34,228,200 (GRCm39)	P1606L	probably damaging	Het
Fnbp1	A	G	2: 30,926,606 (GRCm39)	Y433H	probably damaging	Het
Psg28	A	G	7: 18,156,999 (GRCm39)	I412T	possibly damaging	Het
Ssb	A	G	2: 69,697,703 (GRCm39)	T145A	probably benign	Het
Stx18	T	A	5: 38,264,015 (GRCm39)		probably null	Het
Zfp512b	C	T	2: 181,230,093 (GRCm39)	E515K	possibly damaging	Het

Other mutations in Cd177

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00425:Cd177	APN	7	24,459,176 (GRCm39)	missense	possibly damaging	0.59
IGL00479:Cd177	APN	7	24,457,440 (GRCm39)	missense	probably benign	0.05
IGL00673:Cd177	APN	7	24,451,442 (GRCm39)	missense	possibly damaging	0.78
IGL00913:Cd177	APN	7	24,455,620 (GRCm39)	missense	probably damaging	1.00
IGL01445:Cd177	APN	7	24,451,496 (GRCm39)	missense	possibly damaging	0.95
IGL02021:Cd177	APN	7	24,444,631 (GRCm39)	missense	probably benign	0.16
IGL02134:Cd177	APN	7	24,451,777 (GRCm39)	missense	probably benign	0.01
IGL02532:Cd177	APN	7	24,444,674 (GRCm39)	missense	probably benign	0.30
IGL02821:Cd177	APN	7	24,443,819 (GRCm39)	missense	probably damaging	1.00
IGL02821:Cd177	APN	7	24,443,818 (GRCm39)	missense	probably damaging	1.00
IGL02888:Cd177	APN	7	24,457,862 (GRCm39)	missense	probably damaging	0.99
R0506:Cd177	UTSW	7	24,457,781 (GRCm39)	missense	probably damaging	1.00
R0601:Cd177	UTSW	7	24,451,738 (GRCm39)	missense	probably benign	0.00
R0631:Cd177	UTSW	7	24,456,111 (GRCm39)	missense	probably benign	0.03
R1595:Cd177	UTSW	7	24,444,389 (GRCm39)	missense	probably benign
R1659:Cd177	UTSW	7	24,445,562 (GRCm39)	missense	probably damaging	1.00
R2258:Cd177	UTSW	7	24,455,661 (GRCm39)	missense	possibly damaging	0.73
R2260:Cd177	UTSW	7	24,455,661 (GRCm39)	missense	possibly damaging	0.73
R2379:Cd177	UTSW	7	24,457,468 (GRCm39)	missense	possibly damaging	0.80
R2763:Cd177	UTSW	7	24,457,462 (GRCm39)	missense	probably benign	0.05
R2929:Cd177	UTSW	7	24,453,704 (GRCm39)	nonsense	probably null
R3815:Cd177	UTSW	7	24,453,817 (GRCm39)	missense	probably benign	0.00
R3818:Cd177	UTSW	7	24,453,817 (GRCm39)	missense	probably benign	0.00
R3919:Cd177	UTSW	7	24,443,858 (GRCm39)	missense	probably benign	0.15
R4300:Cd177	UTSW	7	24,449,845 (GRCm39)	missense	possibly damaging	0.48
R4494:Cd177	UTSW	7	24,451,428 (GRCm39)	missense	probably benign	0.06
R4781:Cd177	UTSW	7	24,450,051 (GRCm39)	missense	probably damaging	1.00
R4819:Cd177	UTSW	7	24,451,696 (GRCm39)	missense	probably damaging	1.00
R5062:Cd177	UTSW	7	24,443,741 (GRCm39)	missense	probably benign	0.03
R5186:Cd177	UTSW	7	24,444,348 (GRCm39)	missense	probably benign	0.31
R5285:Cd177	UTSW	7	24,445,674 (GRCm39)	missense	probably benign	0.00
R5415:Cd177	UTSW	7	24,451,816 (GRCm39)	missense	probably damaging	1.00
R5577:Cd177	UTSW	7	24,444,562 (GRCm39)	missense	probably damaging	1.00
R5637:Cd177	UTSW	7	24,455,748 (GRCm39)	missense	probably benign	0.01
R5673:Cd177	UTSW	7	24,449,787 (GRCm39)	missense	probably damaging	1.00
R5731:Cd177	UTSW	7	24,443,846 (GRCm39)	missense	probably damaging	1.00
R5775:Cd177	UTSW	7	24,451,693 (GRCm39)	missense	probably damaging	1.00
R5840:Cd177	UTSW	7	24,457,495 (GRCm39)	missense	probably damaging	0.99
R5870:Cd177	UTSW	7	24,455,757 (GRCm39)	missense	probably benign	0.00
R5872:Cd177	UTSW	7	24,451,688 (GRCm39)	missense	probably null	1.00
R6148:Cd177	UTSW	7	24,443,698 (GRCm39)	nonsense	probably null
R6505:Cd177	UTSW	7	24,443,671 (GRCm39)	missense	probably benign	0.00
R6897:Cd177	UTSW	7	24,444,499 (GRCm39)	missense	probably benign	0.31
R7023:Cd177	UTSW	7	24,459,187 (GRCm39)	missense	probably benign	0.44
R7088:Cd177	UTSW	7	24,444,558 (GRCm39)	nonsense	probably null
R7188:Cd177	UTSW	7	24,456,072 (GRCm39)	missense	probably damaging	1.00
R7366:Cd177	UTSW	7	24,456,147 (GRCm39)	missense	probably damaging	1.00
R7744:Cd177	UTSW	7	24,449,800 (GRCm39)	missense	probably damaging	1.00
R8008:Cd177	UTSW	7	24,451,774 (GRCm39)	missense	not run
R8029:Cd177	UTSW	7	24,455,594 (GRCm39)	nonsense	probably null
R8030:Cd177	UTSW	7	24,455,594 (GRCm39)	nonsense	probably null
R8032:Cd177	UTSW	7	24,455,594 (GRCm39)	nonsense	probably null
R8094:Cd177	UTSW	7	24,443,842 (GRCm39)	missense	probably damaging	0.99
R8121:Cd177	UTSW	7	24,459,067 (GRCm39)	missense	probably benign
R8192:Cd177	UTSW	7	24,453,727 (GRCm39)	missense	probably benign	0.00
R8314:Cd177	UTSW	7	24,450,013 (GRCm39)	missense	probably benign	0.15
R8682:Cd177	UTSW	7	24,459,438 (GRCm39)	missense	possibly damaging	0.92
R8730:Cd177	UTSW	7	24,457,501 (GRCm39)	missense	possibly damaging	0.89
R9185:Cd177	UTSW	7	24,443,668 (GRCm39)	missense	probably benign	0.00
R9217:Cd177	UTSW	7	24,445,550 (GRCm39)	missense	possibly damaging	0.93
R9335:Cd177	UTSW	7	24,443,711 (GRCm39)	missense	probably benign	0.04
R9595:Cd177	UTSW	7	24,451,762 (GRCm39)	missense	probably damaging	1.00
R9796:Cd177	UTSW	7	24,459,169 (GRCm39)	missense	probably benign
Z1176:Cd177	UTSW	7	24,445,596 (GRCm39)	missense	probably benign	0.01
Z1177:Cd177	UTSW	7	24,459,681 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACATCCAGGCCGATAGCCGTAAG -3'
(R):5'- AGAGAGTTGTGCGCTAACTCCAAAG -3'

Sequencing Primer
(F):5'- CGATAGCCGTAAGGTCCAG -3'
(R):5'- CGCTAACTCCAAAGTCTGAGGG -3'

Posted On

2013-07-30