Incidental Mutation 'R8293:1700113H08Rik'
ID638806
Institutional Source Beutler Lab
Gene Symbol 1700113H08Rik
Ensembl Gene ENSMUSG00000047129
Gene NameRIKEN cDNA 1700113H08 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R8293 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location87058045-87230589 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87226002 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 105 (S105P)
Ref Sequence ENSEMBL: ENSMUSP00000130852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169849] [ENSMUST00000189456] [ENSMUST00000189775]
Predicted Effect possibly damaging
Transcript: ENSMUST00000169849
AA Change: S105P

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130852
Gene: ENSMUSG00000047129
AA Change: S105P

DomainStartEndE-ValueType
Pfam:DUF4607 71 325 2.1e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189456
SMART Domains Protein: ENSMUSP00000140447
Gene: ENSMUSG00000047129

DomainStartEndE-ValueType
Pfam:DUF4607 45 206 6.2e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189775
SMART Domains Protein: ENSMUSP00000141184
Gene: ENSMUSG00000047129

DomainStartEndE-ValueType
Pfam:DUF4607 6 160 6.8e-43 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930539E08Rik T C 17: 28,902,890 K468E probably benign Het
A430105I19Rik T A 2: 118,761,315 T115S probably damaging Het
Acsm1 T G 7: 119,638,096 S211A possibly damaging Het
Adam4 T A 12: 81,420,411 R479* probably null Het
Agap3 A C 5: 24,487,885 S439R probably damaging Het
Arap1 A T 7: 101,400,934 H1075L probably benign Het
Arhgef28 T C 13: 97,942,521 E1299G probably benign Het
Cc2d2a A T 5: 43,688,228 I329F probably damaging Het
Cd200r1 A G 16: 44,789,721 N101S probably benign Het
Cfap221 A G 1: 119,981,774 V156A possibly damaging Het
Chrm4 C T 2: 91,928,218 P324S probably benign Het
Chrna1 T A 2: 73,570,506 M227L probably benign Het
Cntln A G 4: 85,033,838 D639G probably damaging Het
Cts8 A G 13: 61,254,068 V5A probably benign Het
Cxcl2 A T 5: 90,904,229 T65S probably damaging Het
Cyp2c39 G T 19: 39,563,967 R368L probably benign Het
D630023F18Rik A T 1: 65,108,780 S205T probably benign Het
Dagla A T 19: 10,252,037 probably null Het
Dtnbp1 G A 13: 44,931,139 T175I probably benign Het
Dtx3 A G 10: 127,191,013 L332P probably damaging Het
E2f4 A G 8: 105,297,819 T27A probably damaging Het
Ep400 A G 5: 110,708,892 F1163L unknown Het
Fam83h ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT 15: 76,002,775 probably benign Het
Fbxo40 T C 16: 36,970,025 D241G probably benign Het
Fus T C 7: 127,972,577 S184P unknown Het
Gabarap C A 11: 69,992,672 T87N possibly damaging Het
Gbp10 A C 5: 105,224,369 V175G probably damaging Het
Gcm2 A G 13: 41,103,170 Y368H probably damaging Het
Heca A G 10: 17,902,263 Y529H probably damaging Het
Incenp G A 19: 9,875,133 R714* probably null Het
Lvrn C A 18: 46,850,565 T125K possibly damaging Het
Ms4a6c T A 19: 11,478,296 S156R probably benign Het
Nab2 C A 10: 127,666,397 R21L possibly damaging Het
Neb A T 2: 52,246,815 M3218K probably benign Het
Nwd2 A G 5: 63,805,320 D749G probably benign Het
Nxpe5 A T 5: 138,230,542 Q7L probably benign Het
Olfr1318 A T 2: 112,156,253 M101L probably benign Het
Olfr1335 T A 4: 118,809,742 T41S probably benign Het
Olfr481 A T 7: 108,081,062 E89D probably benign Het
Olfr943 A G 9: 39,184,393 I72V possibly damaging Het
Pla2g5 A G 4: 138,804,606 I29T probably damaging Het
Prpf31 C T 7: 3,640,918 T499I probably damaging Het
Rnf130 T A 11: 50,095,796 D322E probably benign Het
Ros1 T C 10: 52,087,918 N1770D probably damaging Het
Sacs T A 14: 61,191,099 D202E probably damaging Het
Simc1 A G 13: 54,526,546 I902M probably damaging Het
Slc12a8 A T 16: 33,540,978 M77L probably benign Het
Slc35f2 G A 9: 53,816,940 G366D probably benign Het
Slc44a2 A G 9: 21,353,688 D674G probably damaging Het
Stip1 T C 19: 7,034,250 N139S probably benign Het
Taar8c C T 10: 24,101,117 V266M probably benign Het
Tank T A 2: 61,644,414 I204N possibly damaging Het
Tcerg1 A G 18: 42,560,955 T714A probably benign Het
Tenm3 A T 8: 48,367,422 F334I possibly damaging Het
Ubr1 T C 2: 120,862,721 I1735V probably benign Het
Vps13a A T 19: 16,668,605 S2023T possibly damaging Het
Wdfy4 T C 14: 32,974,261 H2741R Het
Wnt10a G T 1: 74,803,217 R284L probably damaging Het
Other mutations in 1700113H08Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01688:1700113H08Rik APN 10 87165123 missense probably damaging 1.00
IGL01764:1700113H08Rik APN 10 87074046 start codon destroyed probably benign 0.02
IGL02173:1700113H08Rik APN 10 87225892 missense possibly damaging 0.63
IGL02756:1700113H08Rik APN 10 87165108 missense probably damaging 0.99
IGL03202:1700113H08Rik APN 10 87074047 start codon destroyed probably null 0.35
IGL03393:1700113H08Rik APN 10 87074038 utr 5 prime probably benign
R0255:1700113H08Rik UTSW 10 87226045 missense probably damaging 1.00
R0409:1700113H08Rik UTSW 10 87225954 missense probably damaging 0.98
R0744:1700113H08Rik UTSW 10 87165069 missense probably damaging 1.00
R0833:1700113H08Rik UTSW 10 87165069 missense probably damaging 1.00
R1163:1700113H08Rik UTSW 10 87121422 missense probably damaging 0.99
R2128:1700113H08Rik UTSW 10 87230204 missense possibly damaging 0.94
R2129:1700113H08Rik UTSW 10 87230204 missense possibly damaging 0.94
R4108:1700113H08Rik UTSW 10 87225934 missense probably damaging 1.00
R5541:1700113H08Rik UTSW 10 87225946 missense probably benign 0.00
R6345:1700113H08Rik UTSW 10 87226051 missense probably benign 0.43
R6372:1700113H08Rik UTSW 10 87230226 missense possibly damaging 0.92
R6710:1700113H08Rik UTSW 10 87226061 missense probably benign 0.00
R6971:1700113H08Rik UTSW 10 87165041 missense possibly damaging 0.91
R7055:1700113H08Rik UTSW 10 87226221 missense probably damaging 0.99
R7713:1700113H08Rik UTSW 10 87230311 missense possibly damaging 0.80
R7808:1700113H08Rik UTSW 10 87121435 missense probably benign 0.33
R7838:1700113H08Rik UTSW 10 87206199 splice site probably null
Predicted Primers PCR Primer
(F):5'- CAAATCTCTAAGTAGCTGGATCCATC -3'
(R):5'- TGCAGCTTCCAGAGAAATGG -3'

Sequencing Primer
(F):5'- CCTCTCTTCCATTAATCTAGAAGTTG -3'
(R):5'- GCAGCTTCCAGAGAAATGGTATTCAC -3'
Posted On2020-07-28