Incidental Mutation 'R8293:Gcm2'
ID638812
Institutional Source Beutler Lab
Gene Symbol Gcm2
Ensembl Gene ENSMUSG00000021362
Gene Nameglial cells missing homolog 2
SynonymsGcm1-rs2
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.452) question?
Stock #R8293 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location41101427-41111035 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 41103170 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 368 (Y368H)
Ref Sequence ENSEMBL: ENSMUSP00000021791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021791]
Predicted Effect probably damaging
Transcript: ENSMUST00000021791
AA Change: Y368H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021791
Gene: ENSMUSG00000021362
AA Change: Y368H

DomainStartEndE-ValueType
Pfam:GCM 35 172 4.8e-74 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a homolog of the Drosophila glial cells missing gene, which is thought to act as a binary switch between neuronal and glial cell determination. The protein encoded by this gene contains a conserved N-terminal GCM motif that has DNA-binding activity. The protein is a transcription factor that acts as a master regulator of parathyroid development. It has been suggested that this transcription factor might mediate the effect of calcium on parathyroid hormone expression and secretion in parathyroid cells. Mutations in this gene are associated with hypoparathyroidism. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice lack parathyroid glands and exhibit hypocalcemia, hypophosphatemia, a mild abnormal bone phenotype, and partial perinatal lethality. Hypoparathyroidism is observed although parathyroid hormone serum levels are normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700113H08Rik T C 10: 87,226,002 S105P possibly damaging Het
4930539E08Rik T C 17: 28,902,890 K468E probably benign Het
A430105I19Rik T A 2: 118,761,315 T115S probably damaging Het
Acsm1 T G 7: 119,638,096 S211A possibly damaging Het
Adam4 T A 12: 81,420,411 R479* probably null Het
Agap3 A C 5: 24,487,885 S439R probably damaging Het
Arap1 A T 7: 101,400,934 H1075L probably benign Het
Arhgef28 T C 13: 97,942,521 E1299G probably benign Het
Cc2d2a A T 5: 43,688,228 I329F probably damaging Het
Cd200r1 A G 16: 44,789,721 N101S probably benign Het
Cfap221 A G 1: 119,981,774 V156A possibly damaging Het
Chrm4 C T 2: 91,928,218 P324S probably benign Het
Chrna1 T A 2: 73,570,506 M227L probably benign Het
Cntln A G 4: 85,033,838 D639G probably damaging Het
Cts8 A G 13: 61,254,068 V5A probably benign Het
Cxcl2 A T 5: 90,904,229 T65S probably damaging Het
Cyp2c39 G T 19: 39,563,967 R368L probably benign Het
D630023F18Rik A T 1: 65,108,780 S205T probably benign Het
Dagla A T 19: 10,252,037 probably null Het
Dtnbp1 G A 13: 44,931,139 T175I probably benign Het
Dtx3 A G 10: 127,191,013 L332P probably damaging Het
E2f4 A G 8: 105,297,819 T27A probably damaging Het
Ep400 A G 5: 110,708,892 F1163L unknown Het
Fam83h ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT ACTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGTAGGGCTCCCCTTGCGCTCAGGGTAAGCTGGGGT 15: 76,002,775 probably benign Het
Fbxo40 T C 16: 36,970,025 D241G probably benign Het
Fus T C 7: 127,972,577 S184P unknown Het
Gabarap C A 11: 69,992,672 T87N possibly damaging Het
Gbp10 A C 5: 105,224,369 V175G probably damaging Het
Heca A G 10: 17,902,263 Y529H probably damaging Het
Incenp G A 19: 9,875,133 R714* probably null Het
Lvrn C A 18: 46,850,565 T125K possibly damaging Het
Ms4a6c T A 19: 11,478,296 S156R probably benign Het
Nab2 C A 10: 127,666,397 R21L possibly damaging Het
Neb A T 2: 52,246,815 M3218K probably benign Het
Nwd2 A G 5: 63,805,320 D749G probably benign Het
Nxpe5 A T 5: 138,230,542 Q7L probably benign Het
Olfr1318 A T 2: 112,156,253 M101L probably benign Het
Olfr1335 T A 4: 118,809,742 T41S probably benign Het
Olfr481 A T 7: 108,081,062 E89D probably benign Het
Olfr943 A G 9: 39,184,393 I72V possibly damaging Het
Pla2g5 A G 4: 138,804,606 I29T probably damaging Het
Prpf31 C T 7: 3,640,918 T499I probably damaging Het
Rnf130 T A 11: 50,095,796 D322E probably benign Het
Ros1 T C 10: 52,087,918 N1770D probably damaging Het
Sacs T A 14: 61,191,099 D202E probably damaging Het
Simc1 A G 13: 54,526,546 I902M probably damaging Het
Slc12a8 A T 16: 33,540,978 M77L probably benign Het
Slc35f2 G A 9: 53,816,940 G366D probably benign Het
Slc44a2 A G 9: 21,353,688 D674G probably damaging Het
Stip1 T C 19: 7,034,250 N139S probably benign Het
Taar8c C T 10: 24,101,117 V266M probably benign Het
Tank T A 2: 61,644,414 I204N possibly damaging Het
Tcerg1 A G 18: 42,560,955 T714A probably benign Het
Tenm3 A T 8: 48,367,422 F334I possibly damaging Het
Ubr1 T C 2: 120,862,721 I1735V probably benign Het
Vps13a A T 19: 16,668,605 S2023T possibly damaging Het
Wdfy4 T C 14: 32,974,261 H2741R Het
Wnt10a G T 1: 74,803,217 R284L probably damaging Het
Other mutations in Gcm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01312:Gcm2 APN 13 41103131 missense probably damaging 1.00
IGL01476:Gcm2 APN 13 41105741 missense probably damaging 1.00
IGL02034:Gcm2 APN 13 41105793 missense probably damaging 1.00
IGL02186:Gcm2 APN 13 41104649 missense possibly damaging 0.93
IGL02456:Gcm2 APN 13 41103001 missense probably benign 0.01
IGL03142:Gcm2 APN 13 41103235 missense probably benign 0.01
IGL03184:Gcm2 APN 13 41105412 missense probably damaging 1.00
PIT4403001:Gcm2 UTSW 13 41102839 missense probably benign 0.01
R0227:Gcm2 UTSW 13 41105856 missense probably damaging 0.99
R1061:Gcm2 UTSW 13 41105871 missense probably damaging 1.00
R1813:Gcm2 UTSW 13 41105891 missense probably benign 0.19
R2057:Gcm2 UTSW 13 41109954 start codon destroyed probably null 0.28
R2058:Gcm2 UTSW 13 41109954 start codon destroyed probably null 0.28
R2059:Gcm2 UTSW 13 41109954 start codon destroyed probably null 0.28
R2351:Gcm2 UTSW 13 41103618 missense probably benign 0.02
R4653:Gcm2 UTSW 13 41102841 missense probably benign 0.21
R4782:Gcm2 UTSW 13 41103494 missense possibly damaging 0.66
R4799:Gcm2 UTSW 13 41103494 missense possibly damaging 0.66
R5135:Gcm2 UTSW 13 41102959 missense probably benign
R5162:Gcm2 UTSW 13 41103655 missense probably benign 0.01
R5665:Gcm2 UTSW 13 41109911 missense possibly damaging 0.73
R5756:Gcm2 UTSW 13 41109896 missense probably damaging 1.00
R5771:Gcm2 UTSW 13 41103515 missense probably benign 0.40
R5928:Gcm2 UTSW 13 41103398 missense probably benign 0.00
R5977:Gcm2 UTSW 13 41103127 missense probably damaging 0.99
R6394:Gcm2 UTSW 13 41109897 missense probably damaging 1.00
R6578:Gcm2 UTSW 13 41105678 missense probably damaging 1.00
R6798:Gcm2 UTSW 13 41105885 missense probably damaging 1.00
R7088:Gcm2 UTSW 13 41103364 missense probably damaging 0.98
R7413:Gcm2 UTSW 13 41105754 missense probably damaging 1.00
R7456:Gcm2 UTSW 13 41103275 missense probably benign 0.02
Z1088:Gcm2 UTSW 13 41102792 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTGAATGACTCCCTCTTG -3'
(R):5'- CGATGACCCAGATTGGATTCC -3'

Sequencing Primer
(F):5'- CCCTCTTGAGGGTCTAAGGCTG -3'
(R):5'- TGACCCAGATTGGATTCCTCTAAAC -3'
Posted On2020-07-28