Incidental Mutation 'R8294:Olfr1018'
ID638834
Institutional Source Beutler Lab
Gene Symbol Olfr1018
Ensembl Gene ENSMUSG00000043892
Gene Nameolfactory receptor 1018
SynonymsGA_x6K02T2Q125-47301584-47302519, MOR260-5
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R8294 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location85818479-85824221 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 85823187 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 72 (I72N)
Ref Sequence ENSEMBL: ENSMUSP00000151090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054201] [ENSMUST00000214416]
Predicted Effect probably damaging
Transcript: ENSMUST00000054201
AA Change: I72N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000050833
Gene: ENSMUSG00000043892
AA Change: I72N

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 4.1e-59 PFAM
Pfam:7tm_1 42 291 1.2e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214416
AA Change: I72N

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik C T 3: 88,696,608 A244V probably damaging Het
Abca4 T C 3: 122,103,568 V632A possibly damaging Het
Abcf2 CAT CATAAT 5: 24,576,591 probably benign Het
Acat2 T C 17: 12,956,356 I79V probably benign Het
Cecr2 C T 6: 120,733,786 A154V probably damaging Het
Cog3 A C 14: 75,717,179 L650R probably damaging Het
Col12a1 A T 9: 79,699,312 F610I possibly damaging Het
Col24a1 A G 3: 145,481,089 D1215G probably null Het
Ctsh C G 9: 90,068,436 A219G possibly damaging Het
Dnah10 C T 5: 124,782,346 L2126F probably damaging Het
Dock10 A G 1: 80,510,362 V2028A possibly damaging Het
Ece1 T C 4: 137,948,620 V435A possibly damaging Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Hist1h4a A G 13: 23,760,974 F62L probably damaging Het
Hk1 T G 10: 62,295,845 I245L probably benign Het
Hyal6 A C 6: 24,734,379 K104Q possibly damaging Het
Kalrn T C 16: 34,033,584 I2017V probably benign Het
Krt72 A T 15: 101,786,037 L141Q probably damaging Het
Map3k4 C A 17: 12,318,613 A6S unknown Het
Muc6 T C 7: 141,637,350 Y2470C possibly damaging Het
Nrip1 A G 16: 76,292,530 V713A probably damaging Het
Olfr1491 A G 19: 13,705,646 D273G probably benign Het
Olfr303 T C 7: 86,395,279 Y73C probably damaging Het
Olfr742 A G 14: 50,515,626 T141A possibly damaging Het
Paip1 C T 13: 119,450,764 T304I possibly damaging Het
Pde4dip A G 3: 97,767,378 L74P probably damaging Het
Prkch T A 12: 73,759,710 L577H probably damaging Het
Rp1 A G 1: 4,345,997 S1631P probably benign Het
Rph3a A G 5: 120,961,366 F154S probably damaging Het
S1pr5 A G 9: 21,245,004 V42A possibly damaging Het
Scaper G A 9: 55,609,996 L1052F possibly damaging Het
Slc44a2 G T 9: 21,348,347 V597F probably damaging Het
Srsf1 T A 11: 88,048,641 S116T probably benign Het
Ssh2 A G 11: 77,454,201 D1004G probably benign Het
St3gal5 T A 6: 72,097,832 D25E Het
Syt17 A T 7: 118,410,005 Y327N probably damaging Het
T T A 17: 8,434,532 M1K probably null Het
Tmem201 A T 4: 149,731,097 I132N possibly damaging Het
Tmprss15 A T 16: 79,071,288 C211S probably benign Het
Trim36 T C 18: 46,198,521 D7G probably benign Het
Trip11 T A 12: 101,844,901 K1863N possibly damaging Het
Vmn2r13 A T 5: 109,175,112 S104T probably benign Het
Zfp977 T C 7: 42,580,265 T279A probably benign Het
Other mutations in Olfr1018
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01637:Olfr1018 APN 2 85822988 missense probably benign 0.00
IGL02795:Olfr1018 APN 2 85823512 nonsense probably null
IGL03189:Olfr1018 APN 2 85823558 missense probably benign 0.27
IGL03329:Olfr1018 APN 2 85823385 missense probably benign 0.02
IGL03400:Olfr1018 APN 2 85823750 missense probably damaging 1.00
IGL02796:Olfr1018 UTSW 2 85823589 missense probably benign 0.00
R5322:Olfr1018 UTSW 2 85823187 missense probably damaging 0.99
R5597:Olfr1018 UTSW 2 85823460 missense probably damaging 0.96
R6521:Olfr1018 UTSW 2 85823450 missense probably benign 0.01
R6725:Olfr1018 UTSW 2 85823790 missense probably damaging 0.97
R7068:Olfr1018 UTSW 2 85823052 missense probably benign 0.00
R7105:Olfr1018 UTSW 2 85823880 missense probably benign 0.22
R8011:Olfr1018 UTSW 2 85823613 missense possibly damaging 0.90
Z1176:Olfr1018 UTSW 2 85823021 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGGGCTTTCATCTGATCC -3'
(R):5'- AAATGGCTGCCAGTTGGATAC -3'

Sequencing Primer
(F):5'- ATCTGATCCCAAGGTACAGCTGG -3'
(R):5'- TGGTCCATAATAACAGTGTAGTGG -3'
Posted On2020-07-28