Incidental Mutation 'R8294:Epha8'
ID638839
Institutional Source Beutler Lab
Gene Symbol Epha8
Ensembl Gene ENSMUSG00000028661
Gene NameEph receptor A8
SynonymsEphA8, Hek3, Eek
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8294 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location136929419-136956816 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 136938586 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 420 (L420M)
Ref Sequence ENSEMBL: ENSMUSP00000030420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030420]
Predicted Effect probably damaging
Transcript: ENSMUST00000030420
AA Change: L420M

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030420
Gene: ENSMUSG00000028661
AA Change: L420M

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
EPH_lbd 30 203 2.59e-116 SMART
FN3 328 418 4.03e-6 SMART
FN3 439 520 1.67e-12 SMART
Pfam:EphA2_TM 542 631 5.8e-10 PFAM
TyrKc 634 891 1.03e-125 SMART
SAM 926 993 4.74e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. The protein encoded by this gene functions as a receptor for ephrin A2, A3 and A5 and plays a role in short-range contact-mediated axonal guidance during development of the mammalian nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for this targeted mutation are viable, fertile, and grossly normal but exhibit a commissural defect, whereby tectal axons fail to project from the superior colliculus of the midbrain to the contralateral inferior colliculus and instead project to the ipsilateral cervical spinal cord. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik C T 3: 88,696,608 A244V probably damaging Het
Abca4 T C 3: 122,103,568 V632A possibly damaging Het
Abcf2 CAT CATAAT 5: 24,576,591 probably benign Het
Acat2 T C 17: 12,956,356 I79V probably benign Het
Cecr2 C T 6: 120,733,786 A154V probably damaging Het
Cog3 A C 14: 75,717,179 L650R probably damaging Het
Col12a1 A T 9: 79,699,312 F610I possibly damaging Het
Col24a1 A G 3: 145,481,089 D1215G probably null Het
Ctsh C G 9: 90,068,436 A219G possibly damaging Het
Dnah10 C T 5: 124,782,346 L2126F probably damaging Het
Dock10 A G 1: 80,510,362 V2028A possibly damaging Het
Ece1 T C 4: 137,948,620 V435A possibly damaging Het
Hist1h4a A G 13: 23,760,974 F62L probably damaging Het
Hk1 T G 10: 62,295,845 I245L probably benign Het
Hyal6 A C 6: 24,734,379 K104Q possibly damaging Het
Kalrn T C 16: 34,033,584 I2017V probably benign Het
Krt72 A T 15: 101,786,037 L141Q probably damaging Het
Map3k4 C A 17: 12,318,613 A6S unknown Het
Muc6 T C 7: 141,637,350 Y2470C possibly damaging Het
Nrip1 A G 16: 76,292,530 V713A probably damaging Het
Olfr1018 T A 2: 85,823,187 I72N probably damaging Het
Olfr1491 A G 19: 13,705,646 D273G probably benign Het
Olfr303 T C 7: 86,395,279 Y73C probably damaging Het
Olfr742 A G 14: 50,515,626 T141A possibly damaging Het
Paip1 C T 13: 119,450,764 T304I possibly damaging Het
Pde4dip A G 3: 97,767,378 L74P probably damaging Het
Prkch T A 12: 73,759,710 L577H probably damaging Het
Rp1 A G 1: 4,345,997 S1631P probably benign Het
Rph3a A G 5: 120,961,366 F154S probably damaging Het
S1pr5 A G 9: 21,245,004 V42A possibly damaging Het
Scaper G A 9: 55,609,996 L1052F possibly damaging Het
Slc44a2 G T 9: 21,348,347 V597F probably damaging Het
Srsf1 T A 11: 88,048,641 S116T probably benign Het
Ssh2 A G 11: 77,454,201 D1004G probably benign Het
St3gal5 T A 6: 72,097,832 D25E Het
Syt17 A T 7: 118,410,005 Y327N probably damaging Het
T T A 17: 8,434,532 M1K probably null Het
Tmem201 A T 4: 149,731,097 I132N possibly damaging Het
Tmprss15 A T 16: 79,071,288 C211S probably benign Het
Trim36 T C 18: 46,198,521 D7G probably benign Het
Trip11 T A 12: 101,844,901 K1863N possibly damaging Het
Vmn2r13 A T 5: 109,175,112 S104T probably benign Het
Zfp977 T C 7: 42,580,265 T279A probably benign Het
Other mutations in Epha8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Epha8 APN 4 136945810 missense probably damaging 1.00
IGL00960:Epha8 APN 4 136951839 splice site probably null
IGL01124:Epha8 APN 4 136936083 missense probably damaging 1.00
IGL01550:Epha8 APN 4 136931740 missense possibly damaging 0.87
IGL01807:Epha8 APN 4 136931682 missense probably benign 0.08
IGL01844:Epha8 APN 4 136931049 makesense probably null
IGL02167:Epha8 APN 4 136931094 missense probably damaging 1.00
R0255:Epha8 UTSW 4 136940286 missense probably damaging 0.99
R0445:Epha8 UTSW 4 136932400 missense probably damaging 1.00
R1757:Epha8 UTSW 4 136931478 splice site probably null
R1911:Epha8 UTSW 4 136936314 missense probably damaging 1.00
R1936:Epha8 UTSW 4 136940243 missense probably benign 0.08
R2291:Epha8 UTSW 4 136933347 missense probably damaging 1.00
R2359:Epha8 UTSW 4 136946032 missense probably damaging 1.00
R2372:Epha8 UTSW 4 136933010 missense probably damaging 1.00
R4581:Epha8 UTSW 4 136933464 missense probably damaging 1.00
R4747:Epha8 UTSW 4 136938695 frame shift probably null
R4784:Epha8 UTSW 4 136933322 missense probably damaging 1.00
R5156:Epha8 UTSW 4 136938726 missense probably benign 0.14
R5164:Epha8 UTSW 4 136945672 missense possibly damaging 0.93
R5335:Epha8 UTSW 4 136931935 missense probably damaging 1.00
R5480:Epha8 UTSW 4 136935130 missense probably benign
R5552:Epha8 UTSW 4 136931899 missense probably damaging 1.00
R5830:Epha8 UTSW 4 136936390 nonsense probably null
R6017:Epha8 UTSW 4 136931743 missense probably damaging 1.00
R6450:Epha8 UTSW 4 136931899 missense probably damaging 1.00
R6798:Epha8 UTSW 4 136945669 missense probably benign 0.00
R6799:Epha8 UTSW 4 136945669 missense probably benign 0.00
R7060:Epha8 UTSW 4 136931158 missense probably damaging 1.00
R7297:Epha8 UTSW 4 136945913 missense probably damaging 1.00
R7344:Epha8 UTSW 4 136934538 missense probably benign 0.14
R7467:Epha8 UTSW 4 136931088 missense possibly damaging 0.90
R7563:Epha8 UTSW 4 136938789 missense possibly damaging 0.77
R7826:Epha8 UTSW 4 136936187 missense probably benign 0.09
R7845:Epha8 UTSW 4 136936401 missense probably benign 0.04
R7863:Epha8 UTSW 4 136933655 missense probably damaging 1.00
R7904:Epha8 UTSW 4 136931739 missense possibly damaging 0.95
R7918:Epha8 UTSW 4 136934566 missense probably benign 0.12
R8177:Epha8 UTSW 4 136945663 missense probably benign 0.00
R8244:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8266:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8268:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8269:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8289:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8290:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8295:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8299:Epha8 UTSW 4 136938586 missense probably damaging 0.98
RF025:Epha8 UTSW 4 136933037 critical splice acceptor site probably benign
RF054:Epha8 UTSW 4 136933037 critical splice acceptor site probably benign
Z1176:Epha8 UTSW 4 136938696 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AACTGATGACTGCCTCTGTG -3'
(R):5'- ATCACCTACAACGCAGTGTGC -3'

Sequencing Primer
(F):5'- CAGACTGAGTTCTGCTTTCCTATAGG -3'
(R):5'- AGTGGAACTCGCTTCGT -3'
Posted On2020-07-28