Incidental Mutation 'R8294:Ece1'
ID638840
Institutional Source Beutler Lab
Gene Symbol Ece1
Ensembl Gene ENSMUSG00000057530
Gene Nameendothelin converting enzyme 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.765) question?
Stock #R8294 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location137862237-137965229 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 137948620 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 435 (V435A)
Ref Sequence ENSEMBL: ENSMUSP00000099576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102518]
Predicted Effect possibly damaging
Transcript: ENSMUST00000102518
AA Change: V435A

PolyPhen 2 Score 0.600 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099576
Gene: ENSMUSG00000057530
AA Change: V435A

DomainStartEndE-ValueType
transmembrane domain 52 74 N/A INTRINSIC
Pfam:Peptidase_M13_N 105 490 1.2e-112 PFAM
Pfam:Peptidase_M13 549 752 1.8e-77 PFAM
Meta Mutation Damage Score 0.8316 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (42/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in proteolytic processing of endothelin precursors to biologically active peptides. Mutations in this gene are associated with Hirschsprung disease, cardiac defects and autonomic dysfunction. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygotes for targeted null mutations show cardiac and craniofacial abnormalities and embryonic mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik C T 3: 88,696,608 A244V probably damaging Het
Abca4 T C 3: 122,103,568 V632A possibly damaging Het
Abcf2 CAT CATAAT 5: 24,576,591 probably benign Het
Acat2 T C 17: 12,956,356 I79V probably benign Het
Arid3a A T 10: 79,950,701 silent Het
Cecr2 C T 6: 120,733,786 A154V probably damaging Het
Cog3 A C 14: 75,717,179 L650R probably damaging Het
Col12a1 A T 9: 79,699,312 F610I possibly damaging Het
Col24a1 A G 3: 145,481,089 D1215G probably null Het
Ctsh C G 9: 90,068,436 A219G possibly damaging Het
Dnah10 C T 5: 124,782,346 L2126F probably damaging Het
Dock10 A G 1: 80,510,362 V2028A possibly damaging Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Hist1h4a A G 13: 23,760,974 F62L probably damaging Het
Hk1 T G 10: 62,295,845 I245L probably benign Het
Hyal6 A C 6: 24,734,379 K104Q possibly damaging Het
Kalrn T C 16: 34,033,584 I2017V probably benign Het
Krt72 A T 15: 101,786,037 L141Q probably damaging Het
Map3k4 C A 17: 12,318,613 A6S unknown Het
Muc6 T C 7: 141,637,350 Y2470C possibly damaging Het
Nrip1 A G 16: 76,292,530 V713A probably damaging Het
Olfr1018 T A 2: 85,823,187 I72N probably damaging Het
Olfr1491 A G 19: 13,705,646 D273G probably benign Het
Olfr303 T C 7: 86,395,279 Y73C probably damaging Het
Olfr742 A G 14: 50,515,626 T141A possibly damaging Het
Paip1 C T 13: 119,450,764 T304I possibly damaging Het
Pde4dip A G 3: 97,767,378 L74P probably damaging Het
Prkch T A 12: 73,759,710 L577H probably damaging Het
Rp1 A G 1: 4,345,997 S1631P probably benign Het
Rph3a A G 5: 120,961,366 F154S probably damaging Het
S1pr5 A G 9: 21,245,004 V42A possibly damaging Het
Scaper G A 9: 55,609,996 L1052F possibly damaging Het
Slc44a2 G T 9: 21,348,347 V597F probably damaging Het
Srsf1 T A 11: 88,048,641 S116T probably benign Het
Ssh2 A G 11: 77,454,201 D1004G probably benign Het
St3gal5 T A 6: 72,097,832 D25E Het
Syt17 A T 7: 118,410,005 Y327N probably damaging Het
T T A 17: 8,434,532 M1K probably null Het
Tmem201 A T 4: 149,731,097 I132N possibly damaging Het
Tmprss15 A T 16: 79,071,288 C211S probably benign Het
Trim36 T C 18: 46,198,521 D7G probably benign Het
Trip11 T A 12: 101,844,901 K1863N possibly damaging Het
Vmn2r13 A T 5: 109,175,112 S104T probably benign Het
Zfp977 T C 7: 42,580,265 T279A probably benign Het
Other mutations in Ece1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Ece1 APN 4 137938658 missense probably damaging 1.00
IGL01538:Ece1 APN 4 137948544 missense probably benign
IGL01588:Ece1 APN 4 137957206 splice site probably benign
IGL01678:Ece1 APN 4 137962733 missense probably damaging 1.00
IGL02619:Ece1 APN 4 137938733 missense probably benign 0.08
IGL02936:Ece1 APN 4 137946301 missense probably benign 0.01
IGL02956:Ece1 APN 4 137962838 missense probably damaging 0.99
IGL03332:Ece1 APN 4 137946355 missense probably damaging 0.99
R0063:Ece1 UTSW 4 137948581 missense probably benign 0.14
R0240:Ece1 UTSW 4 137949435 splice site probably benign
R1004:Ece1 UTSW 4 137926239 missense probably benign 0.04
R1515:Ece1 UTSW 4 137951508 missense probably benign 0.00
R1541:Ece1 UTSW 4 137948660 splice site probably null
R1796:Ece1 UTSW 4 137958001 missense probably damaging 1.00
R1834:Ece1 UTSW 4 137958001 missense probably damaging 1.00
R1834:Ece1 UTSW 4 137958128 missense probably damaging 0.99
R1836:Ece1 UTSW 4 137958001 missense probably damaging 1.00
R1930:Ece1 UTSW 4 137938763 missense probably benign 0.01
R1931:Ece1 UTSW 4 137938763 missense probably benign 0.01
R2065:Ece1 UTSW 4 137958082 missense probably benign 0.04
R2281:Ece1 UTSW 4 137946362 missense possibly damaging 0.93
R3118:Ece1 UTSW 4 137948544 missense probably benign
R4720:Ece1 UTSW 4 137957175 missense probably damaging 1.00
R4773:Ece1 UTSW 4 137945153 missense probably benign 0.00
R5794:Ece1 UTSW 4 137956533 missense probably damaging 0.99
R5969:Ece1 UTSW 4 137961740 critical splice donor site probably null
R6056:Ece1 UTSW 4 137961647 missense probably damaging 1.00
R6332:Ece1 UTSW 4 137958008 missense probably damaging 1.00
R6648:Ece1 UTSW 4 137921159 missense probably benign 0.00
R7285:Ece1 UTSW 4 137913763 splice site probably null
R7387:Ece1 UTSW 4 137938784 missense possibly damaging 0.69
R8103:Ece1 UTSW 4 137913822 missense probably benign
R8308:Ece1 UTSW 4 137936764 missense probably damaging 0.99
R8806:Ece1 UTSW 4 137945141 missense probably damaging 1.00
X0063:Ece1 UTSW 4 137926375 missense probably damaging 0.97
Z1176:Ece1 UTSW 4 137921027 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- ACGTATCTCTGAAGCGCCAG -3'
(R):5'- CTGGAATCTATGTTAACTGCAGAC -3'

Sequencing Primer
(F):5'- TATCTCTGAAGCGCCAGGAGAAAG -3'
(R):5'- ACTGACATAGTCTCTGTGCAG -3'
Posted On2020-07-28