Incidental Mutation 'R8294:Hyal6'
ID638846
Institutional Source Beutler Lab
Gene Symbol Hyal6
Ensembl Gene ENSMUSG00000029679
Gene Namehyaluronoglucosaminidase 6
Synonyms4932701A20Rik, Hyal-ps1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R8294 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location24733245-24745452 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 24734379 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamine at position 104 (K104Q)
Ref Sequence ENSEMBL: ENSMUSP00000031690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031690]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031690
AA Change: K104Q

PolyPhen 2 Score 0.529 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000031690
Gene: ENSMUSG00000029679
AA Change: K104Q

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Glyco_hydro_56 30 363 4.8e-136 PFAM
EGF 365 438 6.02e0 SMART
transmembrane domain 457 479 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (42/43)
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik C T 3: 88,696,608 A244V probably damaging Het
Abca4 T C 3: 122,103,568 V632A possibly damaging Het
Abcf2 CAT CATAAT 5: 24,576,591 probably benign Het
Acat2 T C 17: 12,956,356 I79V probably benign Het
Arid3a A T 10: 79,950,701 silent Het
Cecr2 C T 6: 120,733,786 A154V probably damaging Het
Cog3 A C 14: 75,717,179 L650R probably damaging Het
Col12a1 A T 9: 79,699,312 F610I possibly damaging Het
Col24a1 A G 3: 145,481,089 D1215G probably null Het
Ctsh C G 9: 90,068,436 A219G possibly damaging Het
Dnah10 C T 5: 124,782,346 L2126F probably damaging Het
Dock10 A G 1: 80,510,362 V2028A possibly damaging Het
Ece1 T C 4: 137,948,620 V435A possibly damaging Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Hist1h4a A G 13: 23,760,974 F62L probably damaging Het
Hk1 T G 10: 62,295,845 I245L probably benign Het
Kalrn T C 16: 34,033,584 I2017V probably benign Het
Krt72 A T 15: 101,786,037 L141Q probably damaging Het
Map3k4 C A 17: 12,318,613 A6S unknown Het
Muc6 T C 7: 141,637,350 Y2470C possibly damaging Het
Nrip1 A G 16: 76,292,530 V713A probably damaging Het
Olfr1018 T A 2: 85,823,187 I72N probably damaging Het
Olfr1491 A G 19: 13,705,646 D273G probably benign Het
Olfr303 T C 7: 86,395,279 Y73C probably damaging Het
Olfr742 A G 14: 50,515,626 T141A possibly damaging Het
Paip1 C T 13: 119,450,764 T304I possibly damaging Het
Pde4dip A G 3: 97,767,378 L74P probably damaging Het
Prkch T A 12: 73,759,710 L577H probably damaging Het
Rp1 A G 1: 4,345,997 S1631P probably benign Het
Rph3a A G 5: 120,961,366 F154S probably damaging Het
S1pr5 A G 9: 21,245,004 V42A possibly damaging Het
Scaper G A 9: 55,609,996 L1052F possibly damaging Het
Slc44a2 G T 9: 21,348,347 V597F probably damaging Het
Srsf1 T A 11: 88,048,641 S116T probably benign Het
Ssh2 A G 11: 77,454,201 D1004G probably benign Het
St3gal5 T A 6: 72,097,832 D25E Het
Syt17 A T 7: 118,410,005 Y327N probably damaging Het
T T A 17: 8,434,532 M1K probably null Het
Tmem201 A T 4: 149,731,097 I132N possibly damaging Het
Tmprss15 A T 16: 79,071,288 C211S probably benign Het
Trim36 T C 18: 46,198,521 D7G probably benign Het
Trip11 T A 12: 101,844,901 K1863N possibly damaging Het
Vmn2r13 A T 5: 109,175,112 S104T probably benign Het
Zfp977 T C 7: 42,580,265 T279A probably benign Het
Other mutations in Hyal6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01351:Hyal6 APN 6 24734179 missense probably damaging 1.00
IGL02269:Hyal6 APN 6 24740859 missense probably damaging 0.97
IGL02729:Hyal6 APN 6 24734695 missense probably damaging 1.00
IGL02793:Hyal6 APN 6 24734379 nonsense probably null
IGL02943:Hyal6 APN 6 24743439 missense probably damaging 0.99
IGL03351:Hyal6 APN 6 24743429 missense probably damaging 1.00
R0481:Hyal6 UTSW 6 24743418 missense probably damaging 1.00
R0517:Hyal6 UTSW 6 24734853 missense probably benign
R0853:Hyal6 UTSW 6 24734073 missense probably benign
R1182:Hyal6 UTSW 6 24743417 missense probably damaging 1.00
R1401:Hyal6 UTSW 6 24743435 missense probably damaging 1.00
R1780:Hyal6 UTSW 6 24734032 splice site probably benign
R1858:Hyal6 UTSW 6 24740858 missense probably benign 0.01
R2011:Hyal6 UTSW 6 24734724 missense possibly damaging 0.69
R3441:Hyal6 UTSW 6 24734593 missense probably benign
R4819:Hyal6 UTSW 6 24734966 nonsense probably null
R5357:Hyal6 UTSW 6 24734518 missense probably benign 0.05
R5648:Hyal6 UTSW 6 24734236 missense possibly damaging 0.61
R5717:Hyal6 UTSW 6 24743691 missense probably benign 0.15
R5884:Hyal6 UTSW 6 24743369 missense probably damaging 1.00
R6657:Hyal6 UTSW 6 24734758 missense possibly damaging 0.61
R6826:Hyal6 UTSW 6 24734372 missense probably damaging 1.00
R7178:Hyal6 UTSW 6 24734835 missense probably benign 0.28
R7531:Hyal6 UTSW 6 24740787 missense possibly damaging 0.46
R7630:Hyal6 UTSW 6 24734584 missense probably damaging 1.00
R7787:Hyal6 UTSW 6 24743736 missense probably damaging 0.99
R7851:Hyal6 UTSW 6 24734498 missense probably benign 0.05
R8132:Hyal6 UTSW 6 24740828 missense possibly damaging 0.80
R8200:Hyal6 UTSW 6 24734566 missense probably benign 0.01
R8300:Hyal6 UTSW 6 24734088 missense probably benign
R8509:Hyal6 UTSW 6 24734606 missense probably damaging 1.00
R8705:Hyal6 UTSW 6 24734674 missense probably benign 0.01
R8917:Hyal6 UTSW 6 24734104 missense possibly damaging 0.96
X0019:Hyal6 UTSW 6 24734667 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCAACGTTTTCTGGGCCG -3'
(R):5'- TTGTTTCTGCCCAGTCAGGATG -3'

Sequencing Primer
(F):5'- CGCCCCTACTTTGTTTTGTAAAG -3'
(R):5'- CCCAGTCAGGATGGTGGTGTC -3'
Posted On2020-07-28