Incidental Mutation 'R8294:Prkch'
ID638861
Institutional Source Beutler Lab
Gene Symbol Prkch
Ensembl Gene ENSMUSG00000021108
Gene Nameprotein kinase C, eta
SynonymsPkch
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8294 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location73584796-73778185 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 73759710 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 577 (L577H)
Ref Sequence ENSEMBL: ENSMUSP00000021527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021527]
Predicted Effect probably damaging
Transcript: ENSMUST00000021527
AA Change: L577H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021527
Gene: ENSMUSG00000021108
AA Change: L577H

DomainStartEndE-ValueType
C2 11 117 1.28e-13 SMART
C1 172 222 7.92e-14 SMART
C1 246 295 2.48e-15 SMART
S_TKc 355 614 5.62e-100 SMART
S_TK_X 615 678 8.32e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119092
AA Change: L577H
SMART Domains Protein: ENSMUSP00000112499
Gene: ENSMUSG00000021108
AA Change: L577H

DomainStartEndE-ValueType
C2 11 117 1.28e-13 SMART
C1 172 222 7.92e-14 SMART
C1 246 295 2.48e-15 SMART
S_TKc 355 597 6.67e-84 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: Protein kinase C (PKC) is a family of serine- and threonine-specific protein kinases that can be activated by calcium and the second messenger diacylglycerol. PKC family members phosphorylate a wide variety of protein targets and are known to be involved in diverse cellular signaling pathways. PKC family members also serve as major receptors for phorbol esters, a class of tumor promoters. Each member of the PKC family has a specific expression profile and is believed to play a distinct role in cells. The protein encoded by this gene is one of the PKC family members. It is a calcium-independent and phospholipids-dependent protein kinase. It is predominantly expressed in epithelial tissues and has been shown to reside specifically in the cell nucleus. This protein kinase can regulate keratinocyte differentiation by activating the MAP kinase MAPK13 (p38delta)-activated protein kinase cascade that targets CCAAT/enhancer-binding protein alpha (CEBPA). It is also found to mediate the transcription activation of the transglutaminase 1 (TGM1) gene. Mutations in the human gene are associated with susceptibility to cerebral infarction. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit thymus hypoplasia, enlarged lymph nodes and alterations in T cell homeostasis and activation. Mice homozygous for a different knock-out allele show impaired wound healing and increased incidence of tumors by chemical induction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik C T 3: 88,696,608 A244V probably damaging Het
Abca4 T C 3: 122,103,568 V632A possibly damaging Het
Abcf2 CAT CATAAT 5: 24,576,591 probably benign Het
Acat2 T C 17: 12,956,356 I79V probably benign Het
Cecr2 C T 6: 120,733,786 A154V probably damaging Het
Cog3 A C 14: 75,717,179 L650R probably damaging Het
Col12a1 A T 9: 79,699,312 F610I possibly damaging Het
Col24a1 A G 3: 145,481,089 D1215G probably null Het
Ctsh C G 9: 90,068,436 A219G possibly damaging Het
Dnah10 C T 5: 124,782,346 L2126F probably damaging Het
Dock10 A G 1: 80,510,362 V2028A possibly damaging Het
Ece1 T C 4: 137,948,620 V435A possibly damaging Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Hist1h4a A G 13: 23,760,974 F62L probably damaging Het
Hk1 T G 10: 62,295,845 I245L probably benign Het
Hyal6 A C 6: 24,734,379 K104Q possibly damaging Het
Kalrn T C 16: 34,033,584 I2017V probably benign Het
Krt72 A T 15: 101,786,037 L141Q probably damaging Het
Map3k4 C A 17: 12,318,613 A6S unknown Het
Muc6 T C 7: 141,637,350 Y2470C possibly damaging Het
Nrip1 A G 16: 76,292,530 V713A probably damaging Het
Olfr1018 T A 2: 85,823,187 I72N probably damaging Het
Olfr1491 A G 19: 13,705,646 D273G probably benign Het
Olfr303 T C 7: 86,395,279 Y73C probably damaging Het
Olfr742 A G 14: 50,515,626 T141A possibly damaging Het
Paip1 C T 13: 119,450,764 T304I possibly damaging Het
Pde4dip A G 3: 97,767,378 L74P probably damaging Het
Rp1 A G 1: 4,345,997 S1631P probably benign Het
Rph3a A G 5: 120,961,366 F154S probably damaging Het
S1pr5 A G 9: 21,245,004 V42A possibly damaging Het
Scaper G A 9: 55,609,996 L1052F possibly damaging Het
Slc44a2 G T 9: 21,348,347 V597F probably damaging Het
Srsf1 T A 11: 88,048,641 S116T probably benign Het
Ssh2 A G 11: 77,454,201 D1004G probably benign Het
St3gal5 T A 6: 72,097,832 D25E Het
Syt17 A T 7: 118,410,005 Y327N probably damaging Het
T T A 17: 8,434,532 M1K probably null Het
Tmem201 A T 4: 149,731,097 I132N possibly damaging Het
Tmprss15 A T 16: 79,071,288 C211S probably benign Het
Trim36 T C 18: 46,198,521 D7G probably benign Het
Trip11 T A 12: 101,844,901 K1863N possibly damaging Het
Vmn2r13 A T 5: 109,175,112 S104T probably benign Het
Zfp977 T C 7: 42,580,265 T279A probably benign Het
Other mutations in Prkch
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Prkch APN 12 73702589 splice site probably benign
IGL00548:Prkch APN 12 73702811 missense probably damaging 1.00
IGL01310:Prkch APN 12 73759013 missense possibly damaging 0.78
IGL01782:Prkch APN 12 73759662 missense probably damaging 1.00
IGL02335:Prkch APN 12 73702512 missense probably benign 0.00
R0084:Prkch UTSW 12 73697987 missense possibly damaging 0.87
R0127:Prkch UTSW 12 73721787 missense possibly damaging 0.94
R0471:Prkch UTSW 12 73691652 missense probably benign 0.03
R0490:Prkch UTSW 12 73759676 missense probably damaging 1.00
R1402:Prkch UTSW 12 73585389 missense probably damaging 1.00
R1402:Prkch UTSW 12 73585389 missense probably damaging 1.00
R1552:Prkch UTSW 12 73702546 missense probably benign 0.33
R1572:Prkch UTSW 12 73649357 critical splice donor site probably null
R1651:Prkch UTSW 12 73759001 missense possibly damaging 0.88
R2114:Prkch UTSW 12 73702516 missense probably benign
R3714:Prkch UTSW 12 73775516 missense probably damaging 1.00
R4515:Prkch UTSW 12 73702838 missense possibly damaging 0.76
R4749:Prkch UTSW 12 73692960 missense probably damaging 1.00
R4977:Prkch UTSW 12 73702893 missense possibly damaging 0.52
R5381:Prkch UTSW 12 73691592 missense probably damaging 0.99
R5682:Prkch UTSW 12 73697950 missense probably damaging 1.00
R6526:Prkch UTSW 12 73702775 missense probably damaging 1.00
R6864:Prkch UTSW 12 73759617 missense probably damaging 1.00
R7484:Prkch UTSW 12 73585527 critical splice donor site probably null
R8074:Prkch UTSW 12 73700267 missense possibly damaging 0.49
R8301:Prkch UTSW 12 73702764 missense possibly damaging 0.71
R8312:Prkch UTSW 12 73760584 missense noncoding transcript
Predicted Primers PCR Primer
(F):5'- GAAACACGCATGTCAGCAAG -3'
(R):5'- TGATGCTGCAGACATTCCCAG -3'

Sequencing Primer
(F):5'- CATGTCAGCAAGCGGGAC -3'
(R):5'- CAGCCTAGGAGAAATTCTTGATTC -3'
Posted On2020-07-28