Mutagenetix > Incidental Mutation

Incidental Mutation 'R8294:Trip11'

638862

Institutional Source

Beutler Lab

Gene Symbol

Trip11

Ensembl Gene

ENSMUSG00000021188

Gene Name

thyroid hormone receptor interactor 11

Synonyms

3110031G15Rik, TRIP230, 2610511G22Rik, GMAP-210, 6030460N08Rik

MMRRC Submission

067784-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R8294 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

101800304-101879463 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 101811160 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Asparagine at position 1863 (K1863N)

Ref Sequence

ENSEMBL: ENSMUSP00000021605 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021605] [ENSMUST00000177183]

AlphaFold

E9Q512

Predicted Effect

possibly damaging
Transcript: ENSMUST00000021605
AA Change: K1863N

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000021605
Gene: ENSMUSG00000021188
AA Change: K1863N

Domain	Start	End	E-Value	Type
low complexity region	2	26	N/A	INTRINSIC
coiled coil region	54	130	N/A	INTRINSIC
coiled coil region	167	194	N/A	INTRINSIC
coiled coil region	218	702	N/A	INTRINSIC
coiled coil region	754	990	N/A	INTRINSIC
coiled coil region	1022	1051	N/A	INTRINSIC
coiled coil region	1196	1261	N/A	INTRINSIC
low complexity region	1310	1322	N/A	INTRINSIC
coiled coil region	1336	1481	N/A	INTRINSIC
coiled coil region	1547	1657	N/A	INTRINSIC
coiled coil region	1681	1771	N/A	INTRINSIC
low complexity region	1934	1945	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000177183
AA Change: K1578N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000134976
Gene: ENSMUSG00000021188
AA Change: K1578N

Domain	Start	End	E-Value	Type
coiled coil region	33	158	N/A	INTRINSIC
coiled coil region	179	417	N/A	INTRINSIC
coiled coil region	469	705	N/A	INTRINSIC
coiled coil region	737	766	N/A	INTRINSIC
coiled coil region	911	976	N/A	INTRINSIC
low complexity region	1025	1037	N/A	INTRINSIC
coiled coil region	1051	1196	N/A	INTRINSIC
coiled coil region	1262	1372	N/A	INTRINSIC
coiled coil region	1396	1486	N/A	INTRINSIC
low complexity region	1649	1660	N/A	INTRINSIC

Meta Mutation Damage Score

0.0602

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

98% (42/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified based on the interaction of its protein product with thyroid hormone receptor beta. This protein is associated with the Golgi apparatus. The N-terminal region of the protein binds Golgi membranes and the C-terminal region binds the minus ends of microtubules; thus, the protein is thought to play a role in assembly and maintenance of the Golgi ribbon structure around the centrosome. Mutations in this gene cause achondrogenesis type IA.[provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality associated with small size, lung hypoplasia, omphalocele, and ventricular septal defects. [provided by MGI curators]

Allele List at MGI

All alleles(12) : Gene trapped(11) Chemically induced(1)

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	T	C	3: 121,897,217 (GRCm39)	V632A	possibly damaging	Het
Abcf2	CAT	CATAAT	5: 24,781,589 (GRCm39)		probably benign	Het
Acat2	T	C	17: 13,175,243 (GRCm39)	I79V	probably benign	Het
Arid3a	A	T	10: 79,786,535 (GRCm39)		silent	Het
Cecr2	C	T	6: 120,710,747 (GRCm39)	A154V	probably damaging	Het
Cog3	A	C	14: 75,954,619 (GRCm39)	L650R	probably damaging	Het
Col12a1	A	T	9: 79,606,594 (GRCm39)	F610I	possibly damaging	Het
Col24a1	A	G	3: 145,186,844 (GRCm39)	D1215G	probably null	Het
Ctsh	C	G	9: 89,950,489 (GRCm39)	A219G	possibly damaging	Het
Dnah10	C	T	5: 124,859,410 (GRCm39)	L2126F	probably damaging	Het
Dock10	A	G	1: 80,488,079 (GRCm39)	V2028A	possibly damaging	Het
Ece1	T	C	4: 137,675,931 (GRCm39)	V435A	possibly damaging	Het
Epha8	G	T	4: 136,665,897 (GRCm39)	L420M	probably damaging	Het
H4c1	A	G	13: 23,944,957 (GRCm39)	F62L	probably damaging	Het
Hk1	T	G	10: 62,131,624 (GRCm39)	I245L	probably benign	Het
Hyal6	A	C	6: 24,734,378 (GRCm39)	K104Q	possibly damaging	Het
Kalrn	T	C	16: 33,853,954 (GRCm39)	I2017V	probably benign	Het
Khdc4	C	T	3: 88,603,915 (GRCm39)	A244V	probably damaging	Het
Krt72	A	T	15: 101,694,472 (GRCm39)	L141Q	probably damaging	Het
Map3k4	C	A	17: 12,537,500 (GRCm39)	A6S	unknown	Het
Muc6	T	C	7: 141,217,263 (GRCm39)	Y2470C	possibly damaging	Het
Nrip1	A	G	16: 76,089,418 (GRCm39)	V713A	probably damaging	Het
Or10q1b	A	G	19: 13,683,010 (GRCm39)	D273G	probably benign	Het
Or11g26	A	G	14: 50,753,083 (GRCm39)	T141A	possibly damaging	Het
Or2ah1	T	A	2: 85,653,531 (GRCm39)	I72N	probably damaging	Het
Or6aa1	T	C	7: 86,044,487 (GRCm39)	Y73C	probably damaging	Het
Paip1	C	T	13: 119,587,300 (GRCm39)	T304I	possibly damaging	Het
Pde4dip	A	G	3: 97,674,694 (GRCm39)	L74P	probably damaging	Het
Prkch	T	A	12: 73,806,484 (GRCm39)	L577H	probably damaging	Het
Rp1	A	G	1: 4,416,220 (GRCm39)	S1631P	probably benign	Het
Rph3a	A	G	5: 121,099,429 (GRCm39)	F154S	probably damaging	Het
S1pr5	A	G	9: 21,156,300 (GRCm39)	V42A	possibly damaging	Het
Scaper	G	A	9: 55,517,280 (GRCm39)	L1052F	possibly damaging	Het
Slc44a2	G	T	9: 21,259,643 (GRCm39)	V597F	probably damaging	Het
Srsf1	T	A	11: 87,939,467 (GRCm39)	S116T	probably benign	Het
Ssh2	A	G	11: 77,345,027 (GRCm39)	D1004G	probably benign	Het
St3gal5	T	A	6: 72,074,816 (GRCm39)	D25E		Het
Syt17	A	T	7: 118,009,228 (GRCm39)	Y327N	probably damaging	Het
T	T	A	17: 8,653,364 (GRCm39)	M1K	probably null	Het
Tmem201	A	T	4: 149,815,554 (GRCm39)	I132N	possibly damaging	Het
Tmprss15	A	T	16: 78,868,176 (GRCm39)	C211S	probably benign	Het
Trim36	T	C	18: 46,331,588 (GRCm39)	D7G	probably benign	Het
Vmn2r13	A	T	5: 109,322,978 (GRCm39)	S104T	probably benign	Het
Zfp977	T	C	7: 42,229,689 (GRCm39)	T279A	probably benign	Het

Other mutations in Trip11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00430:Trip11	APN	12	101,852,406 (GRCm39)	missense	probably benign	0.37
IGL00484:Trip11	APN	12	101,851,570 (GRCm39)	nonsense	probably null
IGL00972:Trip11	APN	12	101,860,596 (GRCm39)	missense	probably null	1.00
IGL01476:Trip11	APN	12	101,865,170 (GRCm39)	missense	probably damaging	0.96
IGL01591:Trip11	APN	12	101,849,604 (GRCm39)	missense	probably damaging	0.98
IGL01667:Trip11	APN	12	101,845,121 (GRCm39)	missense	probably damaging	1.00
IGL01764:Trip11	APN	12	101,850,890 (GRCm39)	missense	probably damaging	1.00
IGL01789:Trip11	APN	12	101,838,090 (GRCm39)	missense	probably benign	0.05
IGL01814:Trip11	APN	12	101,850,747 (GRCm39)	missense	probably damaging	0.98
IGL01898:Trip11	APN	12	101,851,935 (GRCm39)	missense	probably benign
IGL01924:Trip11	APN	12	101,853,143 (GRCm39)	missense	possibly damaging	0.93
IGL02020:Trip11	APN	12	101,850,572 (GRCm39)	missense	probably damaging	1.00
IGL02475:Trip11	APN	12	101,861,942 (GRCm39)	missense	probably benign	0.01
IGL02544:Trip11	APN	12	101,859,780 (GRCm39)	missense	probably damaging	1.00
IGL02678:Trip11	APN	12	101,849,649 (GRCm39)	missense	probably damaging	0.96
IGL02714:Trip11	APN	12	101,850,260 (GRCm39)	missense	probably damaging	1.00
IGL02718:Trip11	APN	12	101,852,284 (GRCm39)	missense	probably benign	0.24
IGL02904:Trip11	APN	12	101,853,097 (GRCm39)	missense	probably damaging	1.00
IGL03012:Trip11	APN	12	101,850,195 (GRCm39)	missense	probably damaging	1.00
IGL03191:Trip11	APN	12	101,865,184 (GRCm39)	missense	probably damaging	1.00
IGL03327:Trip11	APN	12	101,849,677 (GRCm39)	missense	possibly damaging	0.87
IGL03337:Trip11	APN	12	101,851,278 (GRCm39)	missense	probably damaging	1.00
NA:Trip11	UTSW	12	101,860,580 (GRCm39)	splice site	probably null
R0027:Trip11	UTSW	12	101,851,428 (GRCm39)	missense	probably benign	0.00
R0028:Trip11	UTSW	12	101,851,016 (GRCm39)	missense	probably damaging	1.00
R0238:Trip11	UTSW	12	101,850,987 (GRCm39)	missense	probably damaging	1.00
R0238:Trip11	UTSW	12	101,850,987 (GRCm39)	missense	probably damaging	1.00
R0239:Trip11	UTSW	12	101,850,987 (GRCm39)	missense	probably damaging	1.00
R0239:Trip11	UTSW	12	101,850,987 (GRCm39)	missense	probably damaging	1.00
R0505:Trip11	UTSW	12	101,851,931 (GRCm39)	missense	probably damaging	0.98
R0556:Trip11	UTSW	12	101,850,777 (GRCm39)	nonsense	probably null
R0573:Trip11	UTSW	12	101,853,119 (GRCm39)	missense	probably benign	0.02
R0626:Trip11	UTSW	12	101,852,235 (GRCm39)	missense	possibly damaging	0.54
R1519:Trip11	UTSW	12	101,852,419 (GRCm39)	missense	probably benign	0.04
R1530:Trip11	UTSW	12	101,879,026 (GRCm39)	missense	unknown
R1647:Trip11	UTSW	12	101,850,651 (GRCm39)	nonsense	probably null
R1648:Trip11	UTSW	12	101,850,651 (GRCm39)	nonsense	probably null
R1856:Trip11	UTSW	12	101,849,592 (GRCm39)	nonsense	probably null
R2013:Trip11	UTSW	12	101,803,981 (GRCm39)	missense	probably damaging	1.00
R2017:Trip11	UTSW	12	101,851,619 (GRCm39)	missense	probably benign	0.00
R2206:Trip11	UTSW	12	101,839,701 (GRCm39)	missense	probably benign	0.25
R2207:Trip11	UTSW	12	101,839,701 (GRCm39)	missense	probably benign	0.25
R2304:Trip11	UTSW	12	101,865,236 (GRCm39)	missense	possibly damaging	0.58
R2328:Trip11	UTSW	12	101,845,086 (GRCm39)	makesense	probably null
R2513:Trip11	UTSW	12	101,803,986 (GRCm39)	missense	possibly damaging	0.94
R3499:Trip11	UTSW	12	101,859,953 (GRCm39)	missense	possibly damaging	0.87
R4105:Trip11	UTSW	12	101,860,581 (GRCm39)	nonsense	probably null
R4124:Trip11	UTSW	12	101,861,957 (GRCm39)	nonsense	probably null
R4126:Trip11	UTSW	12	101,861,957 (GRCm39)	nonsense	probably null
R4128:Trip11	UTSW	12	101,861,957 (GRCm39)	nonsense	probably null
R4175:Trip11	UTSW	12	101,861,957 (GRCm39)	nonsense	probably null
R4176:Trip11	UTSW	12	101,861,957 (GRCm39)	nonsense	probably null
R4181:Trip11	UTSW	12	101,860,027 (GRCm39)	missense	probably damaging	1.00
R4296:Trip11	UTSW	12	101,852,127 (GRCm39)	nonsense	probably null
R4302:Trip11	UTSW	12	101,860,027 (GRCm39)	missense	probably damaging	1.00
R4306:Trip11	UTSW	12	101,853,198 (GRCm39)	missense	probably benign
R4342:Trip11	UTSW	12	101,850,575 (GRCm39)	missense	probably damaging	1.00
R4576:Trip11	UTSW	12	101,852,499 (GRCm39)	nonsense	probably null
R4586:Trip11	UTSW	12	101,849,600 (GRCm39)	missense	possibly damaging	0.55
R4634:Trip11	UTSW	12	101,803,875 (GRCm39)	missense	probably damaging	1.00
R4696:Trip11	UTSW	12	101,851,549 (GRCm39)	missense	possibly damaging	0.71
R4792:Trip11	UTSW	12	101,851,705 (GRCm39)	missense	probably benign	0.10
R4903:Trip11	UTSW	12	101,853,065 (GRCm39)	critical splice donor site	probably null
R5001:Trip11	UTSW	12	101,851,169 (GRCm39)	nonsense	probably null
R5017:Trip11	UTSW	12	101,812,879 (GRCm39)	missense	probably benign	0.00
R5227:Trip11	UTSW	12	101,851,179 (GRCm39)	missense	probably damaging	1.00
R5231:Trip11	UTSW	12	101,851,860 (GRCm39)	missense	probably damaging	0.96
R5539:Trip11	UTSW	12	101,851,386 (GRCm39)	missense	probably damaging	0.98
R5754:Trip11	UTSW	12	101,851,924 (GRCm39)	nonsense	probably null
R5755:Trip11	UTSW	12	101,851,924 (GRCm39)	nonsense	probably null
R5890:Trip11	UTSW	12	101,852,231 (GRCm39)	missense	probably damaging	0.99
R5910:Trip11	UTSW	12	101,849,738 (GRCm39)	missense	probably damaging	1.00
R6083:Trip11	UTSW	12	101,856,001 (GRCm39)	missense	probably benign	0.00
R6208:Trip11	UTSW	12	101,865,154 (GRCm39)	missense	probably damaging	1.00
R6216:Trip11	UTSW	12	101,856,859 (GRCm39)	missense	probably benign	0.31
R6315:Trip11	UTSW	12	101,851,837 (GRCm39)	missense	possibly damaging	0.84
R6413:Trip11	UTSW	12	101,851,790 (GRCm39)	missense	probably benign	0.12
R6590:Trip11	UTSW	12	101,851,710 (GRCm39)	missense	possibly damaging	0.92
R6690:Trip11	UTSW	12	101,851,710 (GRCm39)	missense	possibly damaging	0.92
R6914:Trip11	UTSW	12	101,812,879 (GRCm39)	missense	probably benign	0.00
R6938:Trip11	UTSW	12	101,803,886 (GRCm39)	missense	probably damaging	0.98
R7015:Trip11	UTSW	12	101,859,942 (GRCm39)	missense	probably damaging	1.00
R7023:Trip11	UTSW	12	101,852,126 (GRCm39)	missense	probably benign	0.13
R7133:Trip11	UTSW	12	101,850,329 (GRCm39)	missense	probably damaging	0.97
R7271:Trip11	UTSW	12	101,850,611 (GRCm39)	missense	probably damaging	1.00
R7424:Trip11	UTSW	12	101,851,457 (GRCm39)	missense	probably damaging	1.00
R7431:Trip11	UTSW	12	101,850,278 (GRCm39)	missense	possibly damaging	0.84
R7472:Trip11	UTSW	12	101,851,639 (GRCm39)	missense	probably benign	0.00
R7491:Trip11	UTSW	12	101,851,694 (GRCm39)	missense	probably damaging	1.00
R7752:Trip11	UTSW	12	101,853,233 (GRCm39)	missense	probably benign	0.01
R7763:Trip11	UTSW	12	101,811,114 (GRCm39)	missense	probably benign	0.03
R7779:Trip11	UTSW	12	101,849,796 (GRCm39)	missense	probably damaging	0.97
R7844:Trip11	UTSW	12	101,844,403 (GRCm39)	missense	probably damaging	1.00
R8055:Trip11	UTSW	12	101,803,924 (GRCm39)	missense	probably damaging	1.00
R8076:Trip11	UTSW	12	101,849,741 (GRCm39)	missense	probably damaging	1.00
R8288:Trip11	UTSW	12	101,860,643 (GRCm39)	missense	possibly damaging	0.73
R8318:Trip11	UTSW	12	101,879,063 (GRCm39)	missense	unknown
R8690:Trip11	UTSW	12	101,839,656 (GRCm39)	missense	possibly damaging	0.76
R8879:Trip11	UTSW	12	101,828,857 (GRCm39)	missense	probably benign	0.00
R8964:Trip11	UTSW	12	101,811,315 (GRCm39)	critical splice donor site	probably null
R9005:Trip11	UTSW	12	101,845,131 (GRCm39)	missense	probably benign	0.02
R9013:Trip11	UTSW	12	101,851,377 (GRCm39)	missense	probably damaging	0.99
R9020:Trip11	UTSW	12	101,850,770 (GRCm39)	missense	possibly damaging	0.91
R9041:Trip11	UTSW	12	101,845,127 (GRCm39)	missense	probably benign	0.06
R9234:Trip11	UTSW	12	101,811,990 (GRCm39)	critical splice donor site	probably null
R9447:Trip11	UTSW	12	101,850,148 (GRCm39)	missense	probably damaging	1.00
R9631:Trip11	UTSW	12	101,859,807 (GRCm39)	missense	probably benign
R9641:Trip11	UTSW	12	101,859,957 (GRCm39)	nonsense	probably null
R9691:Trip11	UTSW	12	101,850,123 (GRCm39)	missense	probably benign	0.00
R9751:Trip11	UTSW	12	101,850,765 (GRCm39)	missense	possibly damaging	0.54
X0020:Trip11	UTSW	12	101,852,172 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CGGCCAATGAAAGATTTCTCATG -3'
(R):5'- GAGACCAAATCAGCAGTCTGTG -3'

Sequencing Primer
(F):5'- GAAGACTCTGGGAATTAGTCCTAC -3'
(R):5'- CAGCAGTCTGTGTTCAATAGTGTAAG -3'

Posted On

2020-07-28