Mutagenetix > Incidental Mutation

Incidental Mutation 'R0697:Crh'

63887

Institutional Source

Beutler Lab

Gene Symbol

Crh

Ensembl Gene

ENSMUSG00000049796

Gene Name

corticotropin releasing hormone

Synonyms

corticotropin releasing factor, corticotropin-releasing factor, CRF, LOC383938

MMRRC Submission

038881-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.363) question?

Stock #

R0697 (G1)

Quality Score

103

Status

Not validated

Chromosome

Chromosomal Location

19693401-19695396 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 19694077 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Cysteine at position 134 (G134C)

Ref Sequence

ENSEMBL: ENSMUSP00000061185 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029139] [ENSMUST00000061294]

AlphaFold

Q8CIT0

Predicted Effect

probably benign
Transcript: ENSMUST00000029139

SMART Domains

Protein: ENSMUSP00000029139
Gene: ENSMUSG00000060913

Domain	Start	End	E-Value	Type
RING	26	81	3.69e-8	SMART
BBOX	119	161	3.58e-6	SMART
Blast:BBC	168	294	2e-33	BLAST
PDB:4M3L\|D	215	272	2e-12	PDB
low complexity region	329	355	N/A	INTRINSIC
low complexity region	384	398	N/A	INTRINSIC
low complexity region	474	485	N/A	INTRINSIC
low complexity region	514	526	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000061294
AA Change: G134C

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000061185
Gene: ENSMUSG00000049796
AA Change: G134C

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	38	56	N/A	INTRINSIC
CRF	146	185	1.55e-16	SMART

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.5%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the corticotropin-releasing factor family and preproprotein that is proteolytically processed to generate a mature protein product. This protein product is a neuropeptide hormone that binds to the corticotropin releasing hormone receptors (CRHR1 and CRHR2) to stimulate the release of adrenocorticotropic hormone from the pituitary gland in response to stress. The encoded protein may also regulate angiogenesis and inflammation. Homozygous knockout mice for this gene exhibit reduced corticosterone levels while the offspring of these mice die perinatally. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous null mice have abnormal adrenal gland morphology, decreased corticosterone levels and abnormal corticosteroid responses to stress. Homozygous litters born from homozygous females display neonatal lethality, impaired lung maturation and delayedcornified and granular layer development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 21 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A1cf	C	A	19: 31,911,167	A99E	probably damaging	Het
Aig1	T	C	10: 13,829,325	N72S	probably benign	Het
Atad2	T	C	15: 58,105,543	I857M	possibly damaging	Het
Ceacam15	A	C	7: 16,673,520	L24*	probably null	Het
Cpsf2	A	G	12: 101,983,184	H53R	probably benign	Het
Cyp2g1	A	T	7: 26,814,727	K253*	probably null	Het
Dna2	T	C	10: 62,949,341	V79A	probably benign	Het
Dsc2	A	G	18: 20,041,452	V549A	probably damaging	Het
Etl4	G	T	2: 20,743,861	V135F	probably damaging	Het
Frk	A	G	10: 34,607,837	H398R	probably benign	Het
Gfra1	A	C	19: 58,270,123	S271A	probably benign	Het
Htr1b	T	C	9: 81,631,463	I364V	possibly damaging	Het
Kcnh5	A	T	12: 74,976,531	C588S	possibly damaging	Het
Kif13a	G	A	13: 46,848,337	T70I	probably benign	Het
Klra6	T	C	6: 130,016,724	I195V	probably benign	Het
Nras	T	C	3: 103,060,300	Y71H	possibly damaging	Het
Sirt5	T	C	13: 43,385,576	F274L	probably damaging	Het
Synj1	T	C	16: 90,960,615	T882A	probably benign	Het
Vmn1r84	A	T	7: 12,362,763	M1K	probably null	Het
Zfhx4	A	T	3: 5,401,733	E2317V	probably damaging	Het
Zfp345	A	T	2: 150,472,909	I236K	probably benign	Het

Other mutations in Crh

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02698:Crh	APN	3	19694190	missense	possibly damaging	0.80
R0047:Crh	UTSW	3	19694037	missense	probably damaging	1.00
R0835:Crh	UTSW	3	19694364	missense	probably benign	0.02
R1201:Crh	UTSW	3	19693926	missense	probably damaging	0.99
R2034:Crh	UTSW	3	19694098	missense	probably damaging	1.00
R2233:Crh	UTSW	3	19693932	missense	probably damaging	1.00
R2234:Crh	UTSW	3	19693932	missense	probably damaging	1.00
R2235:Crh	UTSW	3	19693932	missense	probably damaging	1.00
R5045:Crh	UTSW	3	19693989	nonsense	probably null
R5191:Crh	UTSW	3	19693929	missense	probably damaging	1.00
R5283:Crh	UTSW	3	19694007	missense	probably damaging	1.00
R6481:Crh	UTSW	3	19694337	missense	probably benign	0.13
R6790:Crh	UTSW	3	19694295	missense	probably damaging	1.00
R6865:Crh	UTSW	3	19694140	missense	possibly damaging	0.56
R7259:Crh	UTSW	3	19694254	missense	possibly damaging	0.64
R7758:Crh	UTSW	3	19694289	missense	probably damaging	1.00
R7981:Crh	UTSW	3	19694052	missense	probably benign	0.18
R8247:Crh	UTSW	3	19694127	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- GCCAAGCGCAACATTTCATTTCCC -3'
(R):5'- GGTGAAGAATACTTCCTCCGCCTG -3'

Sequencing Primer
(F):5'- GCAACATTTCATTTCCCGATAATC -3'
(R):5'- CCTGGGGAATCTCAACAGAAGTC -3'

Posted On

2013-07-30