Incidental Mutation 'R0697:Crh'
ID63887
Institutional Source Beutler Lab
Gene Symbol Crh
Ensembl Gene ENSMUSG00000049796
Gene Namecorticotropin releasing hormone
Synonymscorticotropin releasing factor, corticotropin-releasing factor, CRF, LOC383938
MMRRC Submission 038881-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.553) question?
Stock #R0697 (G1)
Quality Score103
Status Not validated
Chromosome3
Chromosomal Location19693401-19695396 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 19694077 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 134 (G134C)
Ref Sequence ENSEMBL: ENSMUSP00000061185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029139] [ENSMUST00000061294]
Predicted Effect probably benign
Transcript: ENSMUST00000029139
SMART Domains Protein: ENSMUSP00000029139
Gene: ENSMUSG00000060913

DomainStartEndE-ValueType
RING 26 81 3.69e-8 SMART
BBOX 119 161 3.58e-6 SMART
Blast:BBC 168 294 2e-33 BLAST
PDB:4M3L|D 215 272 2e-12 PDB
low complexity region 329 355 N/A INTRINSIC
low complexity region 384 398 N/A INTRINSIC
low complexity region 474 485 N/A INTRINSIC
low complexity region 514 526 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000061294
AA Change: G134C

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000061185
Gene: ENSMUSG00000049796
AA Change: G134C

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 38 56 N/A INTRINSIC
CRF 146 185 1.55e-16 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the corticotropin-releasing factor family and preproprotein that is proteolytically processed to generate a mature protein product. This protein product is a neuropeptide hormone that binds to the corticotropin releasing hormone receptors (CRHR1 and CRHR2) to stimulate the release of adrenocorticotropic hormone from the pituitary gland in response to stress. The encoded protein may also regulate angiogenesis and inflammation. Homozygous knockout mice for this gene exhibit reduced corticosterone levels while the offspring of these mice die perinatally. [provided by RefSeq, Aug 2015]
PHENOTYPE: Homozygous null mice have abnormal adrenal gland morphology, decreased corticosterone levels and abnormal corticosteroid responses to stress. Homozygous litters born from homozygous females display neonatal lethality, impaired lung maturation and delayedcornified and granular layer development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf C A 19: 31,911,167 A99E probably damaging Het
Aig1 T C 10: 13,829,325 N72S probably benign Het
Atad2 T C 15: 58,105,543 I857M possibly damaging Het
Ceacam15 A C 7: 16,673,520 L24* probably null Het
Cpsf2 A G 12: 101,983,184 H53R probably benign Het
Cyp2g1 A T 7: 26,814,727 K253* probably null Het
Dna2 T C 10: 62,949,341 V79A probably benign Het
Dsc2 A G 18: 20,041,452 V549A probably damaging Het
Etl4 G T 2: 20,743,861 V135F probably damaging Het
Frk A G 10: 34,607,837 H398R probably benign Het
Gfra1 A C 19: 58,270,123 S271A probably benign Het
Htr1b T C 9: 81,631,463 I364V possibly damaging Het
Kcnh5 A T 12: 74,976,531 C588S possibly damaging Het
Kif13a G A 13: 46,848,337 T70I probably benign Het
Klra6 T C 6: 130,016,724 I195V probably benign Het
Nras T C 3: 103,060,300 Y71H possibly damaging Het
Sirt5 T C 13: 43,385,576 F274L probably damaging Het
Synj1 T C 16: 90,960,615 T882A probably benign Het
Vmn1r84 A T 7: 12,362,763 M1K probably null Het
Zfhx4 A T 3: 5,401,733 E2317V probably damaging Het
Zfp345 A T 2: 150,472,909 I236K probably benign Het
Other mutations in Crh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02698:Crh APN 3 19694190 missense possibly damaging 0.80
R0047:Crh UTSW 3 19694037 missense probably damaging 1.00
R0835:Crh UTSW 3 19694364 missense probably benign 0.02
R1201:Crh UTSW 3 19693926 missense probably damaging 0.99
R2034:Crh UTSW 3 19694098 missense probably damaging 1.00
R2233:Crh UTSW 3 19693932 missense probably damaging 1.00
R2234:Crh UTSW 3 19693932 missense probably damaging 1.00
R2235:Crh UTSW 3 19693932 missense probably damaging 1.00
R5045:Crh UTSW 3 19693989 nonsense probably null
R5191:Crh UTSW 3 19693929 missense probably damaging 1.00
R5283:Crh UTSW 3 19694007 missense probably damaging 1.00
R6481:Crh UTSW 3 19694337 missense probably benign 0.13
R6790:Crh UTSW 3 19694295 missense probably damaging 1.00
R6865:Crh UTSW 3 19694140 missense possibly damaging 0.56
R7259:Crh UTSW 3 19694254 missense possibly damaging 0.64
R7758:Crh UTSW 3 19694289 missense probably damaging 1.00
R7981:Crh UTSW 3 19694052 missense probably benign 0.18
R8247:Crh UTSW 3 19694127 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GCCAAGCGCAACATTTCATTTCCC -3'
(R):5'- GGTGAAGAATACTTCCTCCGCCTG -3'

Sequencing Primer
(F):5'- GCAACATTTCATTTCCCGATAATC -3'
(R):5'- CCTGGGGAATCTCAACAGAAGTC -3'
Posted On2013-07-30