Incidental Mutation 'R8295:Epha8'
ID638883
Institutional Source Beutler Lab
Gene Symbol Epha8
Ensembl Gene ENSMUSG00000028661
Gene NameEph receptor A8
SynonymsEphA8, Hek3, Eek
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8295 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location136929419-136956816 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 136938586 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Methionine at position 420 (L420M)
Ref Sequence ENSEMBL: ENSMUSP00000030420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030420]
Predicted Effect probably damaging
Transcript: ENSMUST00000030420
AA Change: L420M

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030420
Gene: ENSMUSG00000028661
AA Change: L420M

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
EPH_lbd 30 203 2.59e-116 SMART
FN3 328 418 4.03e-6 SMART
FN3 439 520 1.67e-12 SMART
Pfam:EphA2_TM 542 631 5.8e-10 PFAM
TyrKc 634 891 1.03e-125 SMART
SAM 926 993 4.74e-19 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. The protein encoded by this gene functions as a receptor for ephrin A2, A3 and A5 and plays a role in short-range contact-mediated axonal guidance during development of the mammalian nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for this targeted mutation are viable, fertile, and grossly normal but exhibit a commissural defect, whereby tectal axons fail to project from the superior colliculus of the midbrain to the contralateral inferior colliculus and instead project to the ipsilateral cervical spinal cord. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932411E22Rik C T 11: 89,412,097 V32M probably benign Het
Abca15 T G 7: 120,374,965 I915S probably benign Het
Abcf2 CAT CATAAT 5: 24,576,591 probably benign Het
Ahdc1 T A 4: 133,061,451 M1K probably null Het
Akr1c12 T G 13: 4,272,356 D229A probably benign Het
C7 A T 15: 4,988,845 C839S probably damaging Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Ccdc110 A G 8: 45,943,379 D769G probably damaging Het
Clk2 G T 3: 89,173,459 D251Y probably damaging Het
Dlx1 C A 2: 71,532,382 P211Q probably benign Het
Dock8 G A 19: 25,123,236 A703T probably benign Het
Eif2d T A 1: 131,158,251 L161Q probably benign Het
Fndc3a T C 14: 72,552,519 I1079V probably benign Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,089,825 probably benign Het
Gtf3c1 A G 7: 125,663,062 V1104A probably benign Het
H2-Ab1 A T 17: 34,264,842 Y59F probably damaging Het
Ints2 T C 11: 86,225,088 T772A probably damaging Het
Kcnh4 A G 11: 100,749,697 V501A probably benign Het
Ltbp1 A T 17: 75,179,189 T70S probably benign Het
Obox2 A G 7: 15,397,322 T118A probably benign Het
Olfr1048 T C 2: 86,236,572 M88V probably benign Het
Olfr599 C T 7: 103,338,267 T71I probably benign Het
Pih1d2 C T 9: 50,621,079 H146Y probably damaging Het
Pou2af1 C T 9: 51,233,005 S73F possibly damaging Het
Rnase2a T A 14: 51,255,639 I90L probably benign Het
S100a16 T A 3: 90,542,029 C4S probably benign Het
Sprr1a T C 3: 92,484,542 K51E possibly damaging Het
Tmem168 A T 6: 13,602,851 M172K probably damaging Het
Tnrc6b T C 15: 80,913,364 S1371P probably damaging Het
Trav21-dv12 T A 14: 53,876,053 L13* probably null Het
Vmn1r234 T A 17: 21,228,839 V5D probably benign Het
Vmn2r18 A G 5: 151,585,156 C168R probably damaging Het
Vmn2r90 C T 17: 17,728,096 P535S probably benign Het
Zfp595 A G 13: 67,316,700 C503R possibly damaging Het
Other mutations in Epha8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00946:Epha8 APN 4 136945810 missense probably damaging 1.00
IGL00960:Epha8 APN 4 136951839 splice site probably null
IGL01124:Epha8 APN 4 136936083 missense probably damaging 1.00
IGL01550:Epha8 APN 4 136931740 missense possibly damaging 0.87
IGL01807:Epha8 APN 4 136931682 missense probably benign 0.08
IGL01844:Epha8 APN 4 136931049 makesense probably null
IGL02167:Epha8 APN 4 136931094 missense probably damaging 1.00
R0255:Epha8 UTSW 4 136940286 missense probably damaging 0.99
R0445:Epha8 UTSW 4 136932400 missense probably damaging 1.00
R1757:Epha8 UTSW 4 136931478 splice site probably null
R1911:Epha8 UTSW 4 136936314 missense probably damaging 1.00
R1936:Epha8 UTSW 4 136940243 missense probably benign 0.08
R2291:Epha8 UTSW 4 136933347 missense probably damaging 1.00
R2359:Epha8 UTSW 4 136946032 missense probably damaging 1.00
R2372:Epha8 UTSW 4 136933010 missense probably damaging 1.00
R4581:Epha8 UTSW 4 136933464 missense probably damaging 1.00
R4747:Epha8 UTSW 4 136938695 frame shift probably null
R4784:Epha8 UTSW 4 136933322 missense probably damaging 1.00
R5156:Epha8 UTSW 4 136938726 missense probably benign 0.14
R5164:Epha8 UTSW 4 136945672 missense possibly damaging 0.93
R5335:Epha8 UTSW 4 136931935 missense probably damaging 1.00
R5480:Epha8 UTSW 4 136935130 missense probably benign
R5552:Epha8 UTSW 4 136931899 missense probably damaging 1.00
R5830:Epha8 UTSW 4 136936390 nonsense probably null
R6017:Epha8 UTSW 4 136931743 missense probably damaging 1.00
R6450:Epha8 UTSW 4 136931899 missense probably damaging 1.00
R6798:Epha8 UTSW 4 136945669 missense probably benign 0.00
R6799:Epha8 UTSW 4 136945669 missense probably benign 0.00
R7060:Epha8 UTSW 4 136931158 missense probably damaging 1.00
R7297:Epha8 UTSW 4 136945913 missense probably damaging 1.00
R7344:Epha8 UTSW 4 136934538 missense probably benign 0.14
R7467:Epha8 UTSW 4 136931088 missense possibly damaging 0.90
R7563:Epha8 UTSW 4 136938789 missense possibly damaging 0.77
R7826:Epha8 UTSW 4 136936187 missense probably benign 0.09
R7845:Epha8 UTSW 4 136936401 missense probably benign 0.04
R7863:Epha8 UTSW 4 136933655 missense probably damaging 1.00
R7904:Epha8 UTSW 4 136931739 missense possibly damaging 0.95
R7918:Epha8 UTSW 4 136934566 missense probably benign 0.12
R8177:Epha8 UTSW 4 136945663 missense probably benign 0.00
R8244:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8266:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8268:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8269:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8289:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8290:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8294:Epha8 UTSW 4 136938586 missense probably damaging 0.98
R8299:Epha8 UTSW 4 136938586 missense probably damaging 0.98
RF025:Epha8 UTSW 4 136933037 critical splice acceptor site probably benign
RF054:Epha8 UTSW 4 136933037 critical splice acceptor site probably benign
Z1176:Epha8 UTSW 4 136938696 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ACTGATGACTGCCTCTGTGTTC -3'
(R):5'- CATCACCTACAACGCAGTGTG -3'

Sequencing Primer
(F):5'- CAGACTGAGTTCTGCTTTCCTATAGG -3'
(R):5'- CAACGCAGTGTGCCGCC -3'
Posted On2020-07-28