Incidental Mutation 'R8295:Abcf2'
ID638884
Institutional Source Beutler Lab
Gene Symbol Abcf2
Ensembl Gene ENSMUSG00000028953
Gene NameATP-binding cassette, sub-family F (GCN20), member 2
Synonyms0710005O05Rik, Drr3
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.230) question?
Stock #R8295 (G1)
Quality Score217.468
Status Not validated
Chromosome5
Chromosomal Location24565345-24577467 bp(-) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) CAT to CATAAT at 24576591 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030795 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030795]
Predicted Effect probably benign
Transcript: ENSMUST00000030795
SMART Domains Protein: ENSMUSP00000030795
Gene: ENSMUSG00000028953

DomainStartEndE-ValueType
low complexity region 6 19 N/A INTRINSIC
AAA 115 308 1.6e-6 SMART
AAA 427 595 6.32e-5 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ATP-binding cassette (ABC) transporter superfamily. ATP-binding casette proteins transport various molecules across extra- and intracellular membranes. Alterations in this gene may be involved in cancer progression. Alternative splicing results in multiple transcript variants. Related pseudogenes have been identified on chromosomes 3 and 7. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932411E22Rik C T 11: 89,412,097 V32M probably benign Het
Abca15 T G 7: 120,374,965 I915S probably benign Het
Ahdc1 T A 4: 133,061,451 M1K probably null Het
Akr1c12 T G 13: 4,272,356 D229A probably benign Het
C7 A T 15: 4,988,845 C839S probably damaging Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Ccdc110 A G 8: 45,943,379 D769G probably damaging Het
Clk2 G T 3: 89,173,459 D251Y probably damaging Het
Dlx1 C A 2: 71,532,382 P211Q probably benign Het
Dock8 G A 19: 25,123,236 A703T probably benign Het
Eif2d T A 1: 131,158,251 L161Q probably benign Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Fndc3a T C 14: 72,552,519 I1079V probably benign Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,089,825 probably benign Het
Gtf3c1 A G 7: 125,663,062 V1104A probably benign Het
H2-Ab1 A T 17: 34,264,842 Y59F probably damaging Het
Ints2 T C 11: 86,225,088 T772A probably damaging Het
Kcnh4 A G 11: 100,749,697 V501A probably benign Het
Ltbp1 A T 17: 75,179,189 T70S probably benign Het
Obox2 A G 7: 15,397,322 T118A probably benign Het
Olfr1048 T C 2: 86,236,572 M88V probably benign Het
Olfr599 C T 7: 103,338,267 T71I probably benign Het
Pih1d2 C T 9: 50,621,079 H146Y probably damaging Het
Pou2af1 C T 9: 51,233,005 S73F possibly damaging Het
Rnase2a T A 14: 51,255,639 I90L probably benign Het
S100a16 T A 3: 90,542,029 C4S probably benign Het
Sprr1a T C 3: 92,484,542 K51E possibly damaging Het
Tmem168 A T 6: 13,602,851 M172K probably damaging Het
Tnrc6b T C 15: 80,913,364 S1371P probably damaging Het
Trav21-dv12 T A 14: 53,876,053 L13* probably null Het
Vmn1r234 T A 17: 21,228,839 V5D probably benign Het
Vmn2r18 A G 5: 151,585,156 C168R probably damaging Het
Vmn2r90 C T 17: 17,728,096 P535S probably benign Het
Zfp595 A G 13: 67,316,700 C503R possibly damaging Het
Other mutations in Abcf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Abcf2 APN 5 24568796 missense possibly damaging 0.95
IGL02867:Abcf2 APN 5 24571151 missense probably benign 0.03
IGL03325:Abcf2 APN 5 24574212 missense probably damaging 1.00
IGL03329:Abcf2 APN 5 24571248 critical splice acceptor site probably null
R0281:Abcf2 UTSW 5 24566564 missense probably damaging 1.00
R0357:Abcf2 UTSW 5 24573465 missense probably benign 0.16
R0815:Abcf2 UTSW 5 24567270 missense probably damaging 1.00
R0835:Abcf2 UTSW 5 24574253 missense probably damaging 0.99
R1793:Abcf2 UTSW 5 24568776 missense probably benign
R2321:Abcf2 UTSW 5 24567253 nonsense probably null
R5006:Abcf2 UTSW 5 24576537 nonsense probably null
R5765:Abcf2 UTSW 5 24573423 missense probably damaging 0.99
R6317:Abcf2 UTSW 5 24569158 nonsense probably null
R6684:Abcf2 UTSW 5 24569139 missense probably damaging 1.00
R6906:Abcf2 UTSW 5 24568842 missense possibly damaging 0.90
R6980:Abcf2 UTSW 5 24565972 missense probably benign 0.01
R8266:Abcf2 UTSW 5 24576591 small insertion probably benign
R8267:Abcf2 UTSW 5 24576591 small insertion probably benign
R8290:Abcf2 UTSW 5 24576591 small insertion probably benign
R8294:Abcf2 UTSW 5 24576591 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- TGCAGCACCAACCAAGGTAG -3'
(R):5'- GGATGGGATAGCACTCAGAC -3'

Sequencing Primer
(F):5'- GGTGTCACCAAAAAGTTTCATGGC -3'
(R):5'- GGATAGCACTCAGACATTCTTACCTG -3'
Posted On2020-07-28