Incidental Mutation 'R8295:Olfr599'
ID638888
Institutional Source Beutler Lab
Gene Symbol Olfr599
Ensembl Gene ENSMUSG00000073950
Gene Nameolfactory receptor 599
SynonymsGA_x6K02T2PBJ9-6047402-6048349, MOR23-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R8295 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location103335917-103339564 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 103338267 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 71 (T71I)
Ref Sequence ENSEMBL: ENSMUSP00000095803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098201]
Predicted Effect probably benign
Transcript: ENSMUST00000098201
AA Change: T71I

PolyPhen 2 Score 0.080 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000095803
Gene: ENSMUSG00000073950
AA Change: T71I

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 1.8e-94 PFAM
Pfam:7TM_GPCR_Srsx 37 308 1.2e-6 PFAM
Pfam:7tm_1 43 293 2.1e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932411E22Rik C T 11: 89,412,097 V32M probably benign Het
Abca15 T G 7: 120,374,965 I915S probably benign Het
Abcf2 CAT CATAAT 5: 24,576,591 probably benign Het
Ahdc1 T A 4: 133,061,451 M1K probably null Het
Akr1c12 T G 13: 4,272,356 D229A probably benign Het
C7 A T 15: 4,988,845 C839S probably damaging Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Ccdc110 A G 8: 45,943,379 D769G probably damaging Het
Clk2 G T 3: 89,173,459 D251Y probably damaging Het
Dlx1 C A 2: 71,532,382 P211Q probably benign Het
Dock8 G A 19: 25,123,236 A703T probably benign Het
Eif2d T A 1: 131,158,251 L161Q probably benign Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Fndc3a T C 14: 72,552,519 I1079V probably benign Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,089,825 probably benign Het
Gtf3c1 A G 7: 125,663,062 V1104A probably benign Het
H2-Ab1 A T 17: 34,264,842 Y59F probably damaging Het
Ints2 T C 11: 86,225,088 T772A probably damaging Het
Kcnh4 A G 11: 100,749,697 V501A probably benign Het
Ltbp1 A T 17: 75,179,189 T70S probably benign Het
Obox2 A G 7: 15,397,322 T118A probably benign Het
Olfr1048 T C 2: 86,236,572 M88V probably benign Het
Pih1d2 C T 9: 50,621,079 H146Y probably damaging Het
Pou2af1 C T 9: 51,233,005 S73F possibly damaging Het
Rnase2a T A 14: 51,255,639 I90L probably benign Het
S100a16 T A 3: 90,542,029 C4S probably benign Het
Sprr1a T C 3: 92,484,542 K51E possibly damaging Het
Tmem168 A T 6: 13,602,851 M172K probably damaging Het
Tnrc6b T C 15: 80,913,364 S1371P probably damaging Het
Trav21-dv12 T A 14: 53,876,053 L13* probably null Het
Vmn1r234 T A 17: 21,228,839 V5D probably benign Het
Vmn2r18 A G 5: 151,585,156 C168R probably damaging Het
Vmn2r90 C T 17: 17,728,096 P535S probably benign Het
Zfp595 A G 13: 67,316,700 C503R possibly damaging Het
Other mutations in Olfr599
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01386:Olfr599 APN 7 103338767 nonsense probably null
IGL01744:Olfr599 APN 7 103338228 missense probably damaging 0.98
IGL02011:Olfr599 APN 7 103338849 missense probably damaging 0.98
IGL02328:Olfr599 APN 7 103338290 missense probably damaging 1.00
IGL02630:Olfr599 APN 7 103338429 missense probably damaging 1.00
IGL03119:Olfr599 APN 7 103338722 missense probably damaging 1.00
PIT4468001:Olfr599 UTSW 7 103338600 missense probably damaging 1.00
R0599:Olfr599 UTSW 7 103338186 missense probably damaging 1.00
R4084:Olfr599 UTSW 7 103338320 missense probably damaging 0.99
R5068:Olfr599 UTSW 7 103338022 start gained probably null
R5069:Olfr599 UTSW 7 103338022 start gained probably null
R5280:Olfr599 UTSW 7 103338501 missense probably benign
R5816:Olfr599 UTSW 7 103338995 missense probably benign 0.00
R6560:Olfr599 UTSW 7 103338738 missense probably benign 0.02
R7001:Olfr599 UTSW 7 103338221 missense possibly damaging 0.51
R7890:Olfr599 UTSW 7 103338330 missense probably benign
R8430:Olfr599 UTSW 7 103338957 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTCTGATTGGCATCCCTGGAC -3'
(R):5'- TTGCCCGAATTGCAACCAC -3'

Sequencing Primer
(F):5'- ATCCCTGGACTGGAGCATGTG -3'
(R):5'- CTGTGTGCCTCAGAGGATC -3'
Posted On2020-07-28