Incidental Mutation 'R8295:Vmn1r234'
ID638906
Institutional Source Beutler Lab
Gene Symbol Vmn1r234
Ensembl Gene ENSMUSG00000057203
Gene Namevomeronasal 1 receptor 234
SynonymsV1rf1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R8295 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location21228826-21229815 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21228839 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 5 (V5D)
Ref Sequence ENSEMBL: ENSMUSP00000078579 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079633]
Predicted Effect probably benign
Transcript: ENSMUST00000079633
AA Change: V5D

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000078579
Gene: ENSMUSG00000057203
AA Change: V5D

DomainStartEndE-ValueType
Pfam:TAS2R 25 315 2.8e-14 PFAM
Pfam:V1R 57 318 2.3e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932411E22Rik C T 11: 89,412,097 V32M probably benign Het
Abca15 T G 7: 120,374,965 I915S probably benign Het
Abcf2 CAT CATAAT 5: 24,576,591 probably benign Het
Ahdc1 T A 4: 133,061,451 M1K probably null Het
Akr1c12 T G 13: 4,272,356 D229A probably benign Het
C7 A T 15: 4,988,845 C839S probably damaging Het
Card6 TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG TTGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGTGGATGAGAGGGCTTAGCATGGGAGGACTGCGGATGAGAGGGCTTAGCATGGGAGGACTG 15: 5,098,691 probably benign Het
Ccdc110 A G 8: 45,943,379 D769G probably damaging Het
Clk2 G T 3: 89,173,459 D251Y probably damaging Het
Dlx1 C A 2: 71,532,382 P211Q probably benign Het
Dock8 G A 19: 25,123,236 A703T probably benign Het
Eif2d T A 1: 131,158,251 L161Q probably benign Het
Epha8 G T 4: 136,938,586 L420M probably damaging Het
Fndc3a T C 14: 72,552,519 I1079V probably benign Het
Gm21886 ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG ACTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGGCCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGACCTGCAGACAGTAGGTGCTCACTGAGG 18: 80,089,825 probably benign Het
Gtf3c1 A G 7: 125,663,062 V1104A probably benign Het
H2-Ab1 A T 17: 34,264,842 Y59F probably damaging Het
Ints2 T C 11: 86,225,088 T772A probably damaging Het
Kcnh4 A G 11: 100,749,697 V501A probably benign Het
Ltbp1 A T 17: 75,179,189 T70S probably benign Het
Obox2 A G 7: 15,397,322 T118A probably benign Het
Olfr1048 T C 2: 86,236,572 M88V probably benign Het
Olfr599 C T 7: 103,338,267 T71I probably benign Het
Pih1d2 C T 9: 50,621,079 H146Y probably damaging Het
Pou2af1 C T 9: 51,233,005 S73F possibly damaging Het
Rnase2a T A 14: 51,255,639 I90L probably benign Het
S100a16 T A 3: 90,542,029 C4S probably benign Het
Sprr1a T C 3: 92,484,542 K51E possibly damaging Het
Tmem168 A T 6: 13,602,851 M172K probably damaging Het
Tnrc6b T C 15: 80,913,364 S1371P probably damaging Het
Trav21-dv12 T A 14: 53,876,053 L13* probably null Het
Vmn2r18 A G 5: 151,585,156 C168R probably damaging Het
Vmn2r90 C T 17: 17,728,096 P535S probably benign Het
Zfp595 A G 13: 67,316,700 C503R possibly damaging Het
Other mutations in Vmn1r234
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Vmn1r234 APN 17 21229598 missense possibly damaging 0.95
IGL01485:Vmn1r234 APN 17 21228909 missense possibly damaging 0.53
IGL02149:Vmn1r234 APN 17 21229007 missense probably benign 0.00
IGL02291:Vmn1r234 APN 17 21228931 missense probably benign 0.28
IGL02993:Vmn1r234 APN 17 21229703 missense probably damaging 0.99
IGL03223:Vmn1r234 APN 17 21229391 missense probably damaging 0.98
R0626:Vmn1r234 UTSW 17 21229745 missense probably benign 0.17
R1274:Vmn1r234 UTSW 17 21229251 frame shift probably null
R1275:Vmn1r234 UTSW 17 21229251 frame shift probably null
R1288:Vmn1r234 UTSW 17 21229251 frame shift probably null
R1289:Vmn1r234 UTSW 17 21229251 frame shift probably null
R1319:Vmn1r234 UTSW 17 21228910 missense probably benign 0.01
R1412:Vmn1r234 UTSW 17 21229250 missense probably benign 0.01
R2323:Vmn1r234 UTSW 17 21229703 missense probably benign 0.10
R3755:Vmn1r234 UTSW 17 21229009 missense probably damaging 0.98
R4299:Vmn1r234 UTSW 17 21229021 missense probably benign 0.03
R5301:Vmn1r234 UTSW 17 21229327 missense probably benign 0.11
R5741:Vmn1r234 UTSW 17 21229469 missense probably benign 0.21
R6197:Vmn1r234 UTSW 17 21229327 missense probably benign 0.04
R6218:Vmn1r234 UTSW 17 21229721 missense possibly damaging 0.71
R6486:Vmn1r234 UTSW 17 21229342 missense probably benign 0.11
R7482:Vmn1r234 UTSW 17 21229375 missense probably benign 0.07
R7635:Vmn1r234 UTSW 17 21229217 missense probably damaging 1.00
X0028:Vmn1r234 UTSW 17 21228890 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- TGCCTCTCAGTATCCTGAAAC -3'
(R):5'- TGCATCAAAATCCAGTCCATGTG -3'

Sequencing Primer
(F):5'- AGATTCCTTCATCTTCACTGATAACC -3'
(R):5'- CCAGTCCATGTGCTTTAATTTGTATG -3'
Posted On2020-07-28