Incidental Mutation 'R0697:Vmn1r84'
ID63891
Institutional Source Beutler Lab
Gene Symbol Vmn1r84
Ensembl Gene ENSMUSG00000066803
Gene Namevomeronasal 1 receptor 84
SynonymsV1rg11
MMRRC Submission 038881-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R0697 (G1)
Quality Score100
Status Not validated
Chromosome7
Chromosomal Location12360313-12369273 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to T at 12362763 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000083405 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086228] [ENSMUST00000226408] [ENSMUST00000227427] [ENSMUST00000228653]
Predicted Effect probably null
Transcript: ENSMUST00000086228
AA Change: M1K

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000083405
Gene: ENSMUSG00000066803
AA Change: M1K

DomainStartEndE-ValueType
Pfam:TAS2R 16 312 3.7e-11 PFAM
Pfam:V1R 45 308 1.9e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177845
Predicted Effect probably benign
Transcript: ENSMUST00000226408
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226811
Predicted Effect probably benign
Transcript: ENSMUST00000227427
Predicted Effect probably benign
Transcript: ENSMUST00000228653
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228741
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf C A 19: 31,911,167 A99E probably damaging Het
Aig1 T C 10: 13,829,325 N72S probably benign Het
Atad2 T C 15: 58,105,543 I857M possibly damaging Het
Ceacam15 A C 7: 16,673,520 L24* probably null Het
Cpsf2 A G 12: 101,983,184 H53R probably benign Het
Crh C A 3: 19,694,077 G134C probably damaging Het
Cyp2g1 A T 7: 26,814,727 K253* probably null Het
Dna2 T C 10: 62,949,341 V79A probably benign Het
Dsc2 A G 18: 20,041,452 V549A probably damaging Het
Etl4 G T 2: 20,743,861 V135F probably damaging Het
Frk A G 10: 34,607,837 H398R probably benign Het
Gfra1 A C 19: 58,270,123 S271A probably benign Het
Htr1b T C 9: 81,631,463 I364V possibly damaging Het
Kcnh5 A T 12: 74,976,531 C588S possibly damaging Het
Kif13a G A 13: 46,848,337 T70I probably benign Het
Klra6 T C 6: 130,016,724 I195V probably benign Het
Nras T C 3: 103,060,300 Y71H possibly damaging Het
Sirt5 T C 13: 43,385,576 F274L probably damaging Het
Synj1 T C 16: 90,960,615 T882A probably benign Het
Zfhx4 A T 3: 5,401,733 E2317V probably damaging Het
Zfp345 A T 2: 150,472,909 I236K probably benign Het
Other mutations in Vmn1r84
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02505:Vmn1r84 APN 7 12362419 missense probably damaging 1.00
K3955:Vmn1r84 UTSW 7 12361957 missense probably damaging 0.98
R0360:Vmn1r84 UTSW 7 12361872 missense probably damaging 1.00
R0399:Vmn1r84 UTSW 7 12361867 missense probably benign 0.26
R1613:Vmn1r84 UTSW 7 12362533 missense possibly damaging 0.80
R1636:Vmn1r84 UTSW 7 12362595 missense probably benign 0.12
R1872:Vmn1r84 UTSW 7 12362628 missense probably benign 0.17
R4022:Vmn1r84 UTSW 7 12361930 missense probably benign
R4923:Vmn1r84 UTSW 7 12361816 missense probably benign
R5189:Vmn1r84 UTSW 7 12362458 missense probably benign 0.10
R5275:Vmn1r84 UTSW 7 12361814 missense probably benign
R5721:Vmn1r84 UTSW 7 12362226 missense probably damaging 1.00
R6151:Vmn1r84 UTSW 7 12361914 missense possibly damaging 0.72
R7261:Vmn1r84 UTSW 7 12362142 missense probably damaging 1.00
R7513:Vmn1r84 UTSW 7 12362067 missense probably benign 0.00
R7573:Vmn1r84 UTSW 7 12361860 missense probably benign 0.17
R8039:Vmn1r84 UTSW 7 12362008 missense possibly damaging 0.67
R8814:Vmn1r84 UTSW 7 12362458 missense probably damaging 0.99
Z1177:Vmn1r84 UTSW 7 12362512 missense probably benign 0.00
Z1177:Vmn1r84 UTSW 7 12362659 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GCAACCCCAGTTGTACCATTATGTGAG -3'
(R):5'- GCTGGATTACAGGAGTGAATCAGGTC -3'

Sequencing Primer
(F):5'- CTTGAGATAATAACCAAGGAATTGGC -3'
(R):5'- TTACAGGAGTGAATCAGGTCTACTG -3'
Posted On2013-07-30