Incidental Mutation 'R8296:Olfr1090'
ID638919
Institutional Source Beutler Lab
Gene Symbol Olfr1090
Ensembl Gene ENSMUSG00000075172
Gene Nameolfactory receptor 1090
SynonymsGA_x6K02T2Q125-48247345-48246404, MOR188-4
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R8296 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location86752724-86758993 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 86754549 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 63 (L63R)
Ref Sequence ENSEMBL: ENSMUSP00000097460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099875]
Predicted Effect probably damaging
Transcript: ENSMUST00000099875
AA Change: L63R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097460
Gene: ENSMUSG00000075172
AA Change: L63R

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.4e-47 PFAM
Pfam:7tm_1 41 290 7.1e-20 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T A 13: 77,267,777 L663Q probably damaging Het
2610008E11Rik C G 10: 79,067,734 R249S probably benign Het
6030469F06Rik A G 12: 31,185,059 N146S noncoding transcript Het
Abcb5 G A 12: 118,874,732 P1032S probably benign Het
Acvr2a A T 2: 48,899,724 D493V possibly damaging Het
Amacr A G 15: 10,994,918 D272G probably benign Het
Bach1 A C 16: 87,729,579 K643T probably damaging Het
Bmt2 T C 6: 13,628,673 Y337C probably damaging Het
Bsn A G 9: 108,117,379 S566P probably benign Het
Cass4 A C 2: 172,427,174 D392A probably benign Het
Cbx2 A G 11: 119,028,128 E173G probably damaging Het
Ccdc166 G C 15: 75,981,011 A369G probably benign Het
Ccdc77 G A 6: 120,331,909 T315M possibly damaging Het
Ceacam10 C A 7: 24,781,088 H215N unknown Het
Ces1e C T 8: 93,203,319 M445I probably benign Het
Ces2b T G 8: 104,836,480 V350G possibly damaging Het
Chtf18 A G 17: 25,722,191 L611P probably benign Het
Col9a1 C A 1: 24,178,299 P19T unknown Het
Csf1r A T 18: 61,117,678 N487I probably damaging Het
Csl A T 10: 99,758,299 H301Q probably damaging Het
Cyp24a1 G A 2: 170,490,116 T330M probably damaging Het
Ddb2 T C 2: 91,212,300 D405G probably damaging Het
Degs1 A G 1: 182,282,676 F10L probably benign Het
Dhrs2 T A 14: 55,240,471 I220N probably damaging Het
Dlg5 T C 14: 24,148,260 D1535G possibly damaging Het
Dpy19l1 A G 9: 24,503,076 S19P probably benign Het
Eif3l A C 15: 79,079,020 E134A possibly damaging Het
Epb41 C A 4: 131,937,461 V90L Het
Flad1 A T 3: 89,408,802 V151D probably damaging Het
Gja10 A T 4: 32,601,568 I272N probably benign Het
Glmp T A 3: 88,326,273 D178E probably benign Het
Gm16494 G A 17: 47,016,824 P45S probably damaging Het
Gm4553 T C 7: 142,165,721 D6G unknown Het
Grid2 G A 6: 63,256,945 probably null Het
Icmt A G 4: 152,303,025 M226V probably benign Het
Igkv5-39 T C 6: 69,900,623 S50G probably benign Het
Ints5 T C 19: 8,895,120 S148P probably damaging Het
Itga2b A C 11: 102,461,159 V504G possibly damaging Het
Krt20 T A 11: 99,432,237 Y253F probably damaging Het
Man2a2 T A 7: 80,368,908 I68L probably damaging Het
Mpi G A 9: 57,548,671 T176I probably benign Het
Msh6 C T 17: 87,986,912 R1032C probably damaging Het
Myot C T 18: 44,342,349 T179I probably damaging Het
Neb A G 2: 52,226,589 S946P Het
Notch3 G A 17: 32,122,739 A2013V probably damaging Het
Nr1d1 T C 11: 98,771,307 Y167C probably damaging Het
Olfr652 T A 7: 104,564,386 F55Y probably benign Het
Olfr668 T C 7: 104,925,621 I48V probably benign Het
Olfr851 A G 9: 19,497,081 E111G probably damaging Het
P4ha3 G A 7: 100,317,102 V485M probably damaging Het
Pbk T A 14: 65,816,736 C243* probably null Het
Pde4b T A 4: 102,602,786 L388H possibly damaging Het
Pecam1 T C 11: 106,688,919 D439G probably benign Het
Pknox2 A T 9: 36,911,163 M230K probably benign Het
Plekhh2 A G 17: 84,600,685 I1185V probably damaging Het
Polr3g A G 13: 81,694,563 V111A unknown Het
Prkcg G C 7: 3,329,064 E562D probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rnf123 A T 9: 108,062,890 V768D probably damaging Het
Rps16 T A 7: 28,352,583 S129T probably benign Het
Scg2 A T 1: 79,435,505 N460K probably benign Het
Sct T C 7: 141,278,894 S42G probably damaging Het
Spef2 A T 15: 9,727,543 N151K probably benign Het
Syce1l C A 8: 113,654,089 D144E possibly damaging Het
Syt17 T C 7: 118,436,846 Y99C probably damaging Het
Tgfbr3 T C 5: 107,139,774 N520D probably damaging Het
Thsd7b A G 1: 129,595,456 S76G probably benign Het
Tmem63a G T 1: 180,961,120 V341F probably benign Het
Trim5 A G 7: 104,265,786 S359P probably damaging Het
Tst A T 15: 78,399,820 V269E probably damaging Het
Ubr3 A T 2: 69,954,362 I808F probably null Het
Ugt3a2 T A 15: 9,361,938 Y267N probably benign Het
Zfp36l2 G T 17: 84,187,124 N28K probably damaging Het
Zfp57 A G 17: 37,010,244 D330G probably benign Het
Zgrf1 C A 3: 127,583,995 S963Y probably damaging Het
Zranb2 A G 3: 157,541,775 K197E unknown Het
Other mutations in Olfr1090
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01118:Olfr1090 APN 2 86753970 missense probably benign 0.42
IGL01343:Olfr1090 APN 2 86754499 nonsense probably null
IGL01431:Olfr1090 APN 2 86754164 missense probably benign 0.12
IGL01771:Olfr1090 APN 2 86754282 missense probably benign 0.15
IGL03182:Olfr1090 APN 2 86754022 missense probably damaging 1.00
IGL03229:Olfr1090 APN 2 86754016 missense probably damaging 1.00
R0126:Olfr1090 UTSW 2 86754637 missense probably damaging 0.99
R0128:Olfr1090 UTSW 2 86753887 missense probably benign 0.39
R0130:Olfr1090 UTSW 2 86753887 missense probably benign 0.39
R1383:Olfr1090 UTSW 2 86754494 missense possibly damaging 0.80
R2100:Olfr1090 UTSW 2 86754561 missense possibly damaging 0.80
R2125:Olfr1090 UTSW 2 86754452 missense probably benign 0.00
R2126:Olfr1090 UTSW 2 86754452 missense probably benign 0.00
R2249:Olfr1090 UTSW 2 86754054 missense probably damaging 0.98
R3695:Olfr1090 UTSW 2 86753871 missense probably damaging 1.00
R3878:Olfr1090 UTSW 2 86754628 missense probably benign 0.02
R3940:Olfr1090 UTSW 2 86753931 missense possibly damaging 0.52
R3944:Olfr1090 UTSW 2 86754181 missense probably benign 0.17
R3975:Olfr1090 UTSW 2 86754543 missense probably damaging 0.99
R4387:Olfr1090 UTSW 2 86754120 missense probably benign 0.42
R4623:Olfr1090 UTSW 2 86754562 missense possibly damaging 0.80
R4740:Olfr1090 UTSW 2 86753811 missense probably benign 0.00
R6775:Olfr1090 UTSW 2 86754577 missense probably damaging 1.00
R7002:Olfr1090 UTSW 2 86754681 missense probably benign 0.01
R7746:Olfr1090 UTSW 2 86754093 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGGGACATGAGGACAGTG -3'
(R):5'- GAAGGAACACAATCTCACAGTAATG -3'

Sequencing Primer
(F):5'- TTACAGATGGCCACATAGCGGTC -3'
(R):5'- GACTGAATTCATCCTAATGGGTATC -3'
Posted On2020-07-28