Incidental Mutation 'R0697:Ceacam15'
ID63892
Institutional Source Beutler Lab
Gene Symbol Ceacam15
Ensembl Gene ENSMUSG00000078795
Gene Namecarcinoembryonic antigen-related cell adhesion molecule 15
Synonyms
MMRRC Submission 038881-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R0697 (G1)
Quality Score128
Status Not validated
Chromosome7
Chromosomal Location16671331-16675705 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to C at 16673520 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 24 (L24*)
Ref Sequence ENSEMBL: ENSMUSP00000104138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108498]
Predicted Effect probably null
Transcript: ENSMUST00000108498
AA Change: L24*
SMART Domains Protein: ENSMUSP00000104138
Gene: ENSMUSG00000078795
AA Change: L24*

DomainStartEndE-ValueType
IG 39 140 1.28e-1 SMART
IGc2 156 220 2.68e-4 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf C A 19: 31,911,167 A99E probably damaging Het
Aig1 T C 10: 13,829,325 N72S probably benign Het
Atad2 T C 15: 58,105,543 I857M possibly damaging Het
Cpsf2 A G 12: 101,983,184 H53R probably benign Het
Crh C A 3: 19,694,077 G134C probably damaging Het
Cyp2g1 A T 7: 26,814,727 K253* probably null Het
Dna2 T C 10: 62,949,341 V79A probably benign Het
Dsc2 A G 18: 20,041,452 V549A probably damaging Het
Etl4 G T 2: 20,743,861 V135F probably damaging Het
Frk A G 10: 34,607,837 H398R probably benign Het
Gfra1 A C 19: 58,270,123 S271A probably benign Het
Htr1b T C 9: 81,631,463 I364V possibly damaging Het
Kcnh5 A T 12: 74,976,531 C588S possibly damaging Het
Kif13a G A 13: 46,848,337 T70I probably benign Het
Klra6 T C 6: 130,016,724 I195V probably benign Het
Nras T C 3: 103,060,300 Y71H possibly damaging Het
Sirt5 T C 13: 43,385,576 F274L probably damaging Het
Synj1 T C 16: 90,960,615 T882A probably benign Het
Vmn1r84 A T 7: 12,362,763 M1K probably null Het
Zfhx4 A T 3: 5,401,733 E2317V probably damaging Het
Zfp345 A T 2: 150,472,909 I236K probably benign Het
Other mutations in Ceacam15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03367:Ceacam15 APN 7 16675587 missense possibly damaging 0.47
R0144:Ceacam15 UTSW 7 16673191 missense probably benign 0.32
R0517:Ceacam15 UTSW 7 16673520 nonsense probably null
R0612:Ceacam15 UTSW 7 16673520 nonsense probably null
R1077:Ceacam15 UTSW 7 16672075 missense probably benign 0.03
R1257:Ceacam15 UTSW 7 16672024 missense possibly damaging 0.73
R1389:Ceacam15 UTSW 7 16672063 missense probably damaging 0.99
R4602:Ceacam15 UTSW 7 16671981 missense probably damaging 1.00
R4623:Ceacam15 UTSW 7 16673466 missense probably damaging 0.97
R4674:Ceacam15 UTSW 7 16673485 missense probably benign 0.09
R4675:Ceacam15 UTSW 7 16673485 missense probably benign 0.09
R4745:Ceacam15 UTSW 7 16673334 missense probably benign
R5296:Ceacam15 UTSW 7 16673196 missense probably benign 0.09
R5510:Ceacam15 UTSW 7 16672099 missense probably damaging 1.00
R6210:Ceacam15 UTSW 7 16673289 missense probably damaging 0.99
R7414:Ceacam15 UTSW 7 16673310 missense probably benign 0.24
R8110:Ceacam15 UTSW 7 16673409 missense probably benign 0.00
R8341:Ceacam15 UTSW 7 16672003 missense probably benign 0.17
X0020:Ceacam15 UTSW 7 16675606 start codon destroyed probably null 0.00
Z1176:Ceacam15 UTSW 7 16675583 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- CAAGTTGAAGCGAATCGCTGGAC -3'
(R):5'- AGCCAGGGGTTGACTGCAAATAC -3'

Sequencing Primer
(F):5'- GCGAATCGCTGGACTTTTTATAATG -3'
(R):5'- gccagggaaagcatcactaac -3'
Posted On2013-07-30