Mutagenetix > Incidental Mutation

Incidental Mutation 'R0697:Ceacam15'

63892

Institutional Source

Beutler Lab

Gene Symbol

Ceacam15

Ensembl Gene

ENSMUSG00000078795

Gene Name

carcinoembryonic antigen-related cell adhesion molecule 15

Synonyms

MMRRC Submission

038881-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.066) question?

Stock #

R0697 (G1)

Quality Score

128

Status

Not validated

Chromosome

Chromosomal Location

16671331-16675705 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to C at 16673520 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Stop codon at position 24 (L24*)

Ref Sequence

ENSEMBL: ENSMUSP00000104138 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000108498]

AlphaFold

A0A0B4J1L0

Predicted Effect

probably null
Transcript: ENSMUST00000108498
AA Change: L24*

SMART Domains

Protein: ENSMUSP00000104138
Gene: ENSMUSG00000078795
AA Change: L24*

Domain	Start	End	E-Value	Type
IG	39	140	1.28e-1	SMART
IGc2	156	220	2.68e-4	SMART

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.3%
3x: 98.8%
10x: 97.5%
20x: 95.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 21 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A1cf	C	A	19: 31,911,167	A99E	probably damaging	Het
Aig1	T	C	10: 13,829,325	N72S	probably benign	Het
Atad2	T	C	15: 58,105,543	I857M	possibly damaging	Het
Cpsf2	A	G	12: 101,983,184	H53R	probably benign	Het
Crh	C	A	3: 19,694,077	G134C	probably damaging	Het
Cyp2g1	A	T	7: 26,814,727	K253*	probably null	Het
Dna2	T	C	10: 62,949,341	V79A	probably benign	Het
Dsc2	A	G	18: 20,041,452	V549A	probably damaging	Het
Etl4	G	T	2: 20,743,861	V135F	probably damaging	Het
Frk	A	G	10: 34,607,837	H398R	probably benign	Het
Gfra1	A	C	19: 58,270,123	S271A	probably benign	Het
Htr1b	T	C	9: 81,631,463	I364V	possibly damaging	Het
Kcnh5	A	T	12: 74,976,531	C588S	possibly damaging	Het
Kif13a	G	A	13: 46,848,337	T70I	probably benign	Het
Klra6	T	C	6: 130,016,724	I195V	probably benign	Het
Nras	T	C	3: 103,060,300	Y71H	possibly damaging	Het
Sirt5	T	C	13: 43,385,576	F274L	probably damaging	Het
Synj1	T	C	16: 90,960,615	T882A	probably benign	Het
Vmn1r84	A	T	7: 12,362,763	M1K	probably null	Het
Zfhx4	A	T	3: 5,401,733	E2317V	probably damaging	Het
Zfp345	A	T	2: 150,472,909	I236K	probably benign	Het

Other mutations in Ceacam15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL03367:Ceacam15	APN	7	16675587	missense	possibly damaging	0.47
R0144:Ceacam15	UTSW	7	16673191	missense	probably benign	0.32
R0517:Ceacam15	UTSW	7	16673520	nonsense	probably null
R0612:Ceacam15	UTSW	7	16673520	nonsense	probably null
R1077:Ceacam15	UTSW	7	16672075	missense	probably benign	0.03
R1257:Ceacam15	UTSW	7	16672024	missense	possibly damaging	0.73
R1389:Ceacam15	UTSW	7	16672063	missense	probably damaging	0.99
R4602:Ceacam15	UTSW	7	16671981	missense	probably damaging	1.00
R4623:Ceacam15	UTSW	7	16673466	missense	probably damaging	0.97
R4674:Ceacam15	UTSW	7	16673485	missense	probably benign	0.09
R4675:Ceacam15	UTSW	7	16673485	missense	probably benign	0.09
R4745:Ceacam15	UTSW	7	16673334	missense	probably benign
R5296:Ceacam15	UTSW	7	16673196	missense	probably benign	0.09
R5510:Ceacam15	UTSW	7	16672099	missense	probably damaging	1.00
R6210:Ceacam15	UTSW	7	16673289	missense	probably damaging	0.99
R7414:Ceacam15	UTSW	7	16673310	missense	probably benign	0.24
R8110:Ceacam15	UTSW	7	16673409	missense	probably benign	0.00
R8341:Ceacam15	UTSW	7	16672003	missense	probably benign	0.17
R9553:Ceacam15	UTSW	7	16673391	missense	probably damaging	1.00
X0020:Ceacam15	UTSW	7	16675606	start codon destroyed	probably null	0.00
Z1176:Ceacam15	UTSW	7	16675583	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- CAAGTTGAAGCGAATCGCTGGAC -3'
(R):5'- AGCCAGGGGTTGACTGCAAATAC -3'

Sequencing Primer
(F):5'- GCGAATCGCTGGACTTTTTATAATG -3'
(R):5'- gccagggaaagcatcactaac -3'

Posted On

2013-07-30