Incidental Mutation 'R8296:Man2a2'
ID 638939
Institutional Source Beutler Lab
Gene Symbol Man2a2
Ensembl Gene ENSMUSG00000038886
Gene Name mannosidase 2, alpha 2
Synonyms alpha mannosidase IIx, 1700052O22Rik, MX, 4931438M07Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock # R8296 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 80349097-80371375 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 80368908 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 68 (I68L)
Ref Sequence ENSEMBL: ENSMUSP00000095949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098346] [ENSMUST00000205436] [ENSMUST00000206212] [ENSMUST00000206301]
AlphaFold Q8BRK9
Predicted Effect probably damaging
Transcript: ENSMUST00000098346
AA Change: I68L

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095949
Gene: ENSMUSG00000038886
AA Change: I68L

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
coiled coil region 44 75 N/A INTRINSIC
Pfam:Glyco_hydro_38 167 497 1.9e-109 PFAM
Alpha-mann_mid 502 588 1.4e-32 SMART
Pfam:Glyco_hydro_38C 648 1148 1.1e-85 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000205436
Predicted Effect probably benign
Transcript: ENSMUST00000206212
Predicted Effect probably benign
Transcript: ENSMUST00000206301
AA Change: I68L

PolyPhen 2 Score 0.395 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (77/77)
MGI Phenotype PHENOTYPE: Homozygous null males are infertile due to a defect during spermatogenesis involving the premature release of germ cells from the seminiferous tubules into the epididymis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T A 13: 77,267,777 L663Q probably damaging Het
2610008E11Rik C G 10: 79,067,734 R249S probably benign Het
6030469F06Rik A G 12: 31,185,059 N146S noncoding transcript Het
Abcb5 G A 12: 118,874,732 P1032S probably benign Het
Acvr2a A T 2: 48,899,724 D493V possibly damaging Het
Amacr A G 15: 10,994,918 D272G probably benign Het
Bach1 A C 16: 87,729,579 K643T probably damaging Het
Bmt2 T C 6: 13,628,673 Y337C probably damaging Het
Bsn A G 9: 108,117,379 S566P probably benign Het
Cass4 A C 2: 172,427,174 D392A probably benign Het
Cbx2 A G 11: 119,028,128 E173G probably damaging Het
Ccdc166 G C 15: 75,981,011 A369G probably benign Het
Ccdc77 G A 6: 120,331,909 T315M possibly damaging Het
Ceacam10 C A 7: 24,781,088 H215N unknown Het
Ces1e C T 8: 93,203,319 M445I probably benign Het
Ces2b T G 8: 104,836,480 V350G possibly damaging Het
Chtf18 A G 17: 25,722,191 L611P probably benign Het
Col9a1 C A 1: 24,178,299 P19T unknown Het
Csf1r A T 18: 61,117,678 N487I probably damaging Het
Csl A T 10: 99,758,299 H301Q probably damaging Het
Cyp24a1 G A 2: 170,490,116 T330M probably damaging Het
Ddb2 T C 2: 91,212,300 D405G probably damaging Het
Degs1 A G 1: 182,282,676 F10L probably benign Het
Dhrs2 T A 14: 55,240,471 I220N probably damaging Het
Dlg5 T C 14: 24,148,260 D1535G possibly damaging Het
Dpy19l1 A G 9: 24,503,076 S19P probably benign Het
Eif3l A C 15: 79,079,020 E134A possibly damaging Het
Epb41 C A 4: 131,937,461 V90L Het
Flad1 A T 3: 89,408,802 V151D probably damaging Het
Gja10 A T 4: 32,601,568 I272N probably benign Het
Glmp T A 3: 88,326,273 D178E probably benign Het
Gm16494 G A 17: 47,016,824 P45S probably damaging Het
Gm4553 T C 7: 142,165,721 D6G unknown Het
Grid2 G A 6: 63,256,945 probably null Het
Icmt A G 4: 152,303,025 M226V probably benign Het
Igkv5-39 T C 6: 69,900,623 S50G probably benign Het
Ints5 T C 19: 8,895,120 S148P probably damaging Het
Itga2b A C 11: 102,461,159 V504G possibly damaging Het
Krt20 T A 11: 99,432,237 Y253F probably damaging Het
Mpi G A 9: 57,548,671 T176I probably benign Het
Msh6 C T 17: 87,986,912 R1032C probably damaging Het
Myot C T 18: 44,342,349 T179I probably damaging Het
Neb A G 2: 52,226,589 S946P Het
Notch3 G A 17: 32,122,739 A2013V probably damaging Het
Nr1d1 T C 11: 98,771,307 Y167C probably damaging Het
Olfr1090 A C 2: 86,754,549 L63R probably damaging Het
Olfr652 T A 7: 104,564,386 F55Y probably benign Het
Olfr668 T C 7: 104,925,621 I48V probably benign Het
Olfr851 A G 9: 19,497,081 E111G probably damaging Het
P4ha3 G A 7: 100,317,102 V485M probably damaging Het
Pbk T A 14: 65,816,736 C243* probably null Het
Pde4b T A 4: 102,602,786 L388H possibly damaging Het
Pecam1 T C 11: 106,688,919 D439G probably benign Het
Pknox2 A T 9: 36,911,163 M230K probably benign Het
Plekhh2 A G 17: 84,600,685 I1185V probably damaging Het
Polr3g A G 13: 81,694,563 V111A unknown Het
Prkcg G C 7: 3,329,064 E562D probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rnf123 A T 9: 108,062,890 V768D probably damaging Het
Rps16 T A 7: 28,352,583 S129T probably benign Het
Scg2 A T 1: 79,435,505 N460K probably benign Het
Sct T C 7: 141,278,894 S42G probably damaging Het
Spef2 A T 15: 9,727,543 N151K probably benign Het
Syce1l C A 8: 113,654,089 D144E possibly damaging Het
Syt17 T C 7: 118,436,846 Y99C probably damaging Het
Tgfbr3 T C 5: 107,139,774 N520D probably damaging Het
Thsd7b A G 1: 129,595,456 S76G probably benign Het
Tmem63a G T 1: 180,961,120 V341F probably benign Het
Trim5 A G 7: 104,265,786 S359P probably damaging Het
Tst A T 15: 78,399,820 V269E probably damaging Het
Ubr3 A T 2: 69,954,362 I808F probably null Het
Ugt3a2 T A 15: 9,361,938 Y267N probably benign Het
Wwc1 A T 11: 35,870,557 probably benign Het
Zfp36l2 G T 17: 84,187,124 N28K probably damaging Het
Zfp57 A G 17: 37,010,244 D330G probably benign Het
Zgrf1 C A 3: 127,583,995 S963Y probably damaging Het
Zranb2 A G 3: 157,541,775 K197E unknown Het
Other mutations in Man2a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01319:Man2a2 APN 7 80361132 missense possibly damaging 0.94
IGL01405:Man2a2 APN 7 80360934 missense probably benign 0.00
IGL01717:Man2a2 APN 7 80367365 missense probably damaging 1.00
IGL01843:Man2a2 APN 7 80362906 missense probably benign
IGL02212:Man2a2 APN 7 80362308 missense probably benign 0.00
IGL02383:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02434:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02493:Man2a2 APN 7 80369615 missense possibly damaging 0.68
IGL02528:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02529:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02530:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02534:Man2a2 APN 7 80359640 missense probably damaging 0.99
IGL02869:Man2a2 APN 7 80363941 missense probably benign 0.00
IGL03084:Man2a2 APN 7 80352943 missense possibly damaging 0.88
IGL03088:Man2a2 APN 7 80359334 missense possibly damaging 0.91
IGL03377:Man2a2 APN 7 80359052 splice site probably null
IGL03412:Man2a2 APN 7 80366998 missense probably damaging 1.00
dugong UTSW 7 80360921 missense probably benign 0.12
R2090_Man2a2_705 UTSW 7 80364110 unclassified probably benign
R7828_Man2a2_437 UTSW 7 80366926 missense probably damaging 0.98
R0112:Man2a2 UTSW 7 80358276 missense probably damaging 0.99
R0119:Man2a2 UTSW 7 80367405 missense probably damaging 1.00
R0646:Man2a2 UTSW 7 80363197 missense possibly damaging 0.53
R1184:Man2a2 UTSW 7 80362965 missense possibly damaging 0.79
R1445:Man2a2 UTSW 7 80368562 missense probably benign 0.06
R1626:Man2a2 UTSW 7 80367702 missense probably damaging 1.00
R1739:Man2a2 UTSW 7 80362438 missense probably benign 0.10
R1820:Man2a2 UTSW 7 80358933 missense probably benign 0.22
R2090:Man2a2 UTSW 7 80364110 unclassified probably benign
R2144:Man2a2 UTSW 7 80363516 missense probably damaging 1.00
R2150:Man2a2 UTSW 7 80367784 missense probably damaging 1.00
R3882:Man2a2 UTSW 7 80362315 missense possibly damaging 0.70
R4181:Man2a2 UTSW 7 80351739 missense possibly damaging 0.79
R4285:Man2a2 UTSW 7 80368619 missense probably damaging 1.00
R4302:Man2a2 UTSW 7 80351739 missense possibly damaging 0.79
R4440:Man2a2 UTSW 7 80351715 missense probably benign 0.37
R4494:Man2a2 UTSW 7 80359275 splice site probably null
R4564:Man2a2 UTSW 7 80368838 missense probably benign 0.00
R4631:Man2a2 UTSW 7 80362463 missense probably benign 0.10
R5328:Man2a2 UTSW 7 80368756 missense probably benign 0.06
R5329:Man2a2 UTSW 7 80361128 missense possibly damaging 0.82
R5468:Man2a2 UTSW 7 80352981 missense probably damaging 0.98
R5774:Man2a2 UTSW 7 80368358 missense probably damaging 1.00
R5824:Man2a2 UTSW 7 80353032 missense probably benign 0.00
R5915:Man2a2 UTSW 7 80360921 missense probably benign 0.12
R5937:Man2a2 UTSW 7 80363503 missense probably damaging 1.00
R6101:Man2a2 UTSW 7 80367001 missense probably damaging 1.00
R6105:Man2a2 UTSW 7 80367001 missense probably damaging 1.00
R6481:Man2a2 UTSW 7 80364071 missense probably damaging 0.99
R6592:Man2a2 UTSW 7 80353199 missense probably damaging 0.98
R6869:Man2a2 UTSW 7 80362945 missense probably benign 0.35
R6918:Man2a2 UTSW 7 80353192 missense possibly damaging 0.91
R7137:Man2a2 UTSW 7 80359751 missense probably benign 0.19
R7236:Man2a2 UTSW 7 80368905 missense probably damaging 1.00
R7496:Man2a2 UTSW 7 80352997 missense probably damaging 1.00
R7522:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7523:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7524:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7583:Man2a2 UTSW 7 80366944 missense probably damaging 1.00
R7681:Man2a2 UTSW 7 80351749 missense possibly damaging 0.49
R7828:Man2a2 UTSW 7 80366926 missense probably damaging 0.98
R7843:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7845:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7847:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7848:Man2a2 UTSW 7 80368865 missense probably benign 0.00
R7984:Man2a2 UTSW 7 80353308 missense probably damaging 0.99
R8194:Man2a2 UTSW 7 80361018 missense probably benign
R8376:Man2a2 UTSW 7 80360923 nonsense probably null
R8515:Man2a2 UTSW 7 80368290 missense possibly damaging 0.88
R8842:Man2a2 UTSW 7 80353319 missense probably damaging 1.00
R9205:Man2a2 UTSW 7 80361120 missense probably benign
R9563:Man2a2 UTSW 7 80356353 missense not run
X0057:Man2a2 UTSW 7 80362324 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAGTTCTGGCTTCTGACCC -3'
(R):5'- GCCTTGTGTAATAATAGCCTGAC -3'

Sequencing Primer
(F):5'- GGCTTCTGACCCCGTCC -3'
(R):5'- AGCCTGACTTAAGTTTCTGGCAGAC -3'
Posted On 2020-07-28