Incidental Mutation 'R8296:Rnf123'
ID 638954
Institutional Source Beutler Lab
Gene Symbol Rnf123
Ensembl Gene ENSMUSG00000041528
Gene Name ring finger protein 123
Synonyms KPC1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.332) question?
Stock # R8296 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 108051534-108083346 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 108062890 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 768 (V768D)
Ref Sequence ENSEMBL: ENSMUSP00000125745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047746] [ENSMUST00000160249] [ENSMUST00000160649] [ENSMUST00000162355] [ENSMUST00000162753] [ENSMUST00000178267]
AlphaFold Q5XPI3
Predicted Effect probably damaging
Transcript: ENSMUST00000047746
AA Change: V768D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040803
Gene: ENSMUSG00000041528
AA Change: V768D

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159306
SMART Domains Protein: ENSMUSP00000125695
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
coiled coil region 172 192 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160249
AA Change: V762D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528
AA Change: V762D

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160649
AA Change: V762D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125495
Gene: ENSMUSG00000041528
AA Change: V762D

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162355
AA Change: V768D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125745
Gene: ENSMUSG00000041528
AA Change: V768D

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162753
Predicted Effect probably damaging
Transcript: ENSMUST00000178267
AA Change: V762D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136953
Gene: ENSMUSG00000041528
AA Change: V762D

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (77/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a C-terminal RING finger domain, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions, and an N-terminal SPRY domain. This protein displays E3 ubiquitin ligase activity toward the cyclin-dependent kinase inhibitor 1B which is also known as p27 or KIP1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T A 13: 77,267,777 L663Q probably damaging Het
2610008E11Rik C G 10: 79,067,734 R249S probably benign Het
6030469F06Rik A G 12: 31,185,059 N146S noncoding transcript Het
Abcb5 G A 12: 118,874,732 P1032S probably benign Het
Acvr2a A T 2: 48,899,724 D493V possibly damaging Het
Amacr A G 15: 10,994,918 D272G probably benign Het
Bach1 A C 16: 87,729,579 K643T probably damaging Het
Bmt2 T C 6: 13,628,673 Y337C probably damaging Het
Bsn A G 9: 108,117,379 S566P probably benign Het
Cass4 A C 2: 172,427,174 D392A probably benign Het
Cbx2 A G 11: 119,028,128 E173G probably damaging Het
Ccdc166 G C 15: 75,981,011 A369G probably benign Het
Ccdc77 G A 6: 120,331,909 T315M possibly damaging Het
Ceacam10 C A 7: 24,781,088 H215N unknown Het
Ces1e C T 8: 93,203,319 M445I probably benign Het
Ces2b T G 8: 104,836,480 V350G possibly damaging Het
Chtf18 A G 17: 25,722,191 L611P probably benign Het
Col9a1 C A 1: 24,178,299 P19T unknown Het
Csf1r A T 18: 61,117,678 N487I probably damaging Het
Csl A T 10: 99,758,299 H301Q probably damaging Het
Cyp24a1 G A 2: 170,490,116 T330M probably damaging Het
Ddb2 T C 2: 91,212,300 D405G probably damaging Het
Degs1 A G 1: 182,282,676 F10L probably benign Het
Dhrs2 T A 14: 55,240,471 I220N probably damaging Het
Dlg5 T C 14: 24,148,260 D1535G possibly damaging Het
Dpy19l1 A G 9: 24,503,076 S19P probably benign Het
Eif3l A C 15: 79,079,020 E134A possibly damaging Het
Epb41 C A 4: 131,937,461 V90L Het
Flad1 A T 3: 89,408,802 V151D probably damaging Het
Gja10 A T 4: 32,601,568 I272N probably benign Het
Glmp T A 3: 88,326,273 D178E probably benign Het
Gm16494 G A 17: 47,016,824 P45S probably damaging Het
Gm4553 T C 7: 142,165,721 D6G unknown Het
Grid2 G A 6: 63,256,945 probably null Het
Icmt A G 4: 152,303,025 M226V probably benign Het
Igkv5-39 T C 6: 69,900,623 S50G probably benign Het
Ints5 T C 19: 8,895,120 S148P probably damaging Het
Itga2b A C 11: 102,461,159 V504G possibly damaging Het
Krt20 T A 11: 99,432,237 Y253F probably damaging Het
Man2a2 T A 7: 80,368,908 I68L probably damaging Het
Mpi G A 9: 57,548,671 T176I probably benign Het
Msh6 C T 17: 87,986,912 R1032C probably damaging Het
Myot C T 18: 44,342,349 T179I probably damaging Het
Neb A G 2: 52,226,589 S946P Het
Notch3 G A 17: 32,122,739 A2013V probably damaging Het
Nr1d1 T C 11: 98,771,307 Y167C probably damaging Het
Olfr1090 A C 2: 86,754,549 L63R probably damaging Het
Olfr652 T A 7: 104,564,386 F55Y probably benign Het
Olfr668 T C 7: 104,925,621 I48V probably benign Het
Olfr851 A G 9: 19,497,081 E111G probably damaging Het
P4ha3 G A 7: 100,317,102 V485M probably damaging Het
Pbk T A 14: 65,816,736 C243* probably null Het
Pde4b T A 4: 102,602,786 L388H possibly damaging Het
Pecam1 T C 11: 106,688,919 D439G probably benign Het
Pknox2 A T 9: 36,911,163 M230K probably benign Het
Plekhh2 A G 17: 84,600,685 I1185V probably damaging Het
Polr3g A G 13: 81,694,563 V111A unknown Het
Prkcg G C 7: 3,329,064 E562D probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rps16 T A 7: 28,352,583 S129T probably benign Het
Scg2 A T 1: 79,435,505 N460K probably benign Het
Sct T C 7: 141,278,894 S42G probably damaging Het
Spef2 A T 15: 9,727,543 N151K probably benign Het
Syce1l C A 8: 113,654,089 D144E possibly damaging Het
Syt17 T C 7: 118,436,846 Y99C probably damaging Het
Tgfbr3 T C 5: 107,139,774 N520D probably damaging Het
Thsd7b A G 1: 129,595,456 S76G probably benign Het
Tmem63a G T 1: 180,961,120 V341F probably benign Het
Trim5 A G 7: 104,265,786 S359P probably damaging Het
Tst A T 15: 78,399,820 V269E probably damaging Het
Ubr3 A T 2: 69,954,362 I808F probably null Het
Ugt3a2 T A 15: 9,361,938 Y267N probably benign Het
Wwc1 A T 11: 35,870,557 probably benign Het
Zfp36l2 G T 17: 84,187,124 N28K probably damaging Het
Zfp57 A G 17: 37,010,244 D330G probably benign Het
Zgrf1 C A 3: 127,583,995 S963Y probably damaging Het
Zranb2 A G 3: 157,541,775 K197E unknown Het
Other mutations in Rnf123
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Rnf123 APN 9 108067395 critical splice donor site probably null
IGL01358:Rnf123 APN 9 108069182 missense probably damaging 1.00
IGL01464:Rnf123 APN 9 108052302 missense probably damaging 1.00
IGL01637:Rnf123 APN 9 108058238 missense probably damaging 1.00
IGL01669:Rnf123 APN 9 108058356 missense probably damaging 0.98
IGL01905:Rnf123 APN 9 108071370 splice site probably benign
IGL02070:Rnf123 APN 9 108068302 nonsense probably null
IGL02072:Rnf123 APN 9 108068302 nonsense probably null
IGL02073:Rnf123 APN 9 108068302 nonsense probably null
IGL02074:Rnf123 APN 9 108066889 missense probably damaging 1.00
IGL02079:Rnf123 APN 9 108068302 nonsense probably null
IGL02080:Rnf123 APN 9 108068302 nonsense probably null
IGL02231:Rnf123 APN 9 108066399 missense probably benign 0.17
IGL02281:Rnf123 APN 9 108071452 missense probably benign 0.01
IGL02336:Rnf123 APN 9 108061842 missense probably damaging 1.00
IGL02543:Rnf123 APN 9 108066348 missense probably damaging 1.00
IGL02565:Rnf123 APN 9 108052212 critical splice donor site probably null
IGL02571:Rnf123 APN 9 108068302 nonsense probably null
IGL02572:Rnf123 APN 9 108068302 nonsense probably null
IGL02574:Rnf123 APN 9 108068302 nonsense probably null
IGL02586:Rnf123 APN 9 108068302 nonsense probably null
IGL02589:Rnf123 APN 9 108068302 nonsense probably null
IGL02600:Rnf123 APN 9 108068302 nonsense probably null
IGL02601:Rnf123 APN 9 108068302 nonsense probably null
IGL02602:Rnf123 APN 9 108068302 nonsense probably null
IGL02603:Rnf123 APN 9 108068302 nonsense probably null
IGL02609:Rnf123 APN 9 108068302 nonsense probably null
IGL02628:Rnf123 APN 9 108068302 nonsense probably null
IGL02629:Rnf123 APN 9 108068302 nonsense probably null
IGL02629:Rnf123 APN 9 108070789 splice site probably benign
IGL02630:Rnf123 APN 9 108068302 nonsense probably null
IGL02631:Rnf123 APN 9 108068302 nonsense probably null
IGL02632:Rnf123 APN 9 108068302 nonsense probably null
IGL02650:Rnf123 APN 9 108069748 missense probably benign 0.29
IGL02690:Rnf123 APN 9 108068302 nonsense probably null
IGL02691:Rnf123 APN 9 108068302 nonsense probably null
IGL02692:Rnf123 APN 9 108068302 nonsense probably null
IGL02693:Rnf123 APN 9 108068302 nonsense probably null
IGL02713:Rnf123 APN 9 108068302 nonsense probably null
IGL02736:Rnf123 APN 9 108068302 nonsense probably null
IGL02929:Rnf123 APN 9 108069076 missense probably benign
R1175:Rnf123 UTSW 9 108077373 missense probably benign
R1465:Rnf123 UTSW 9 108071466 splice site probably benign
R1502:Rnf123 UTSW 9 108068510 splice site probably null
R1682:Rnf123 UTSW 9 108077398 missense probably benign 0.16
R1817:Rnf123 UTSW 9 108062926 missense probably benign 0.41
R1855:Rnf123 UTSW 9 108061791 missense probably damaging 1.00
R2394:Rnf123 UTSW 9 108063536 missense probably benign 0.00
R2483:Rnf123 UTSW 9 108063521 missense probably benign 0.16
R3896:Rnf123 UTSW 9 108069103 splice site probably benign
R3940:Rnf123 UTSW 9 108064035 splice site probably benign
R4206:Rnf123 UTSW 9 108063963 missense probably benign 0.01
R4641:Rnf123 UTSW 9 108058587 missense probably damaging 1.00
R4714:Rnf123 UTSW 9 108052439 splice site probably null
R4767:Rnf123 UTSW 9 108052089 missense probably damaging 1.00
R4849:Rnf123 UTSW 9 108056091 missense probably damaging 1.00
R4899:Rnf123 UTSW 9 108063680 missense probably damaging 1.00
R5274:Rnf123 UTSW 9 108064003 frame shift probably null
R5275:Rnf123 UTSW 9 108064003 frame shift probably null
R5276:Rnf123 UTSW 9 108064003 frame shift probably null
R5294:Rnf123 UTSW 9 108064003 frame shift probably null
R5295:Rnf123 UTSW 9 108064003 frame shift probably null
R5394:Rnf123 UTSW 9 108070731 missense probably damaging 1.00
R5717:Rnf123 UTSW 9 108067424 missense probably damaging 1.00
R6186:Rnf123 UTSW 9 108069958 missense possibly damaging 0.55
R6449:Rnf123 UTSW 9 108056053 missense probably benign 0.17
R6502:Rnf123 UTSW 9 108068332 missense possibly damaging 0.46
R6944:Rnf123 UTSW 9 108063623 missense probably benign 0.02
R7003:Rnf123 UTSW 9 108063683 critical splice acceptor site probably null
R7088:Rnf123 UTSW 9 108058536 missense probably null 1.00
R7092:Rnf123 UTSW 9 108068600 missense probably benign 0.07
R7100:Rnf123 UTSW 9 108056639 missense probably damaging 1.00
R7257:Rnf123 UTSW 9 108069029 missense probably damaging 1.00
R7453:Rnf123 UTSW 9 108070408 splice site probably null
R7468:Rnf123 UTSW 9 108069009 missense probably benign 0.00
R7517:Rnf123 UTSW 9 108070274 nonsense probably null
R7577:Rnf123 UTSW 9 108070619 missense probably damaging 1.00
R8322:Rnf123 UTSW 9 108068507 missense probably benign 0.26
R8754:Rnf123 UTSW 9 108071164 missense probably damaging 1.00
R8783:Rnf123 UTSW 9 108069073 missense probably benign
R9052:Rnf123 UTSW 9 108059731 missense probably damaging 1.00
R9156:Rnf123 UTSW 9 108063028 splice site probably benign
R9170:Rnf123 UTSW 9 108071176 missense probably damaging 1.00
R9332:Rnf123 UTSW 9 108067505 missense probably benign 0.00
R9385:Rnf123 UTSW 9 108052268 missense probably benign 0.02
R9394:Rnf123 UTSW 9 108065706 missense probably damaging 1.00
R9432:Rnf123 UTSW 9 108059809 missense probably damaging 0.96
R9717:Rnf123 UTSW 9 108077764 missense probably benign 0.43
Z1176:Rnf123 UTSW 9 108058395 missense probably damaging 1.00
Z1176:Rnf123 UTSW 9 108062981 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACCTAGTCTGGACCCAGC -3'
(R):5'- CCAGGAGCTTGTGAATATTTAAGAG -3'

Sequencing Primer
(F):5'- GCCTGCAAAGTTCCCAAAATTG -3'
(R):5'- TTAAGGTCAGCCAGGTCTGCATAC -3'
Posted On 2020-07-28