Incidental Mutation 'R8296:Rnf123'
ID638954
Institutional Source Beutler Lab
Gene Symbol Rnf123
Ensembl Gene ENSMUSG00000041528
Gene Namering finger protein 123
SynonymsKPC1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.257) question?
Stock #R8296 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location108051534-108083346 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 108062890 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 768 (V768D)
Ref Sequence ENSEMBL: ENSMUSP00000125745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047746] [ENSMUST00000160249] [ENSMUST00000160649] [ENSMUST00000162355] [ENSMUST00000162753] [ENSMUST00000178267]
Predicted Effect probably damaging
Transcript: ENSMUST00000047746
AA Change: V768D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040803
Gene: ENSMUSG00000041528
AA Change: V768D

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159306
SMART Domains Protein: ENSMUSP00000125695
Gene: ENSMUSG00000041528

DomainStartEndE-ValueType
coiled coil region 172 192 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000160249
AA Change: V762D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124548
Gene: ENSMUSG00000041528
AA Change: V762D

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000160649
AA Change: V762D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125495
Gene: ENSMUSG00000041528
AA Change: V762D

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162355
AA Change: V768D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125745
Gene: ENSMUSG00000041528
AA Change: V768D

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1047 1067 N/A INTRINSIC
low complexity region 1242 1251 N/A INTRINSIC
RING 1260 1297 5.27e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162753
Predicted Effect probably damaging
Transcript: ENSMUST00000178267
AA Change: V762D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136953
Gene: ENSMUSG00000041528
AA Change: V762D

DomainStartEndE-ValueType
low complexity region 104 115 N/A INTRINSIC
SPRY 132 253 1.52e-28 SMART
low complexity region 471 488 N/A INTRINSIC
low complexity region 508 518 N/A INTRINSIC
coiled coil region 1041 1061 N/A INTRINSIC
low complexity region 1236 1245 N/A INTRINSIC
RING 1254 1291 5.27e-4 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a C-terminal RING finger domain, a motif present in a variety of functionally distinct proteins and known to be involved in protein-protein and protein-DNA interactions, and an N-terminal SPRY domain. This protein displays E3 ubiquitin ligase activity toward the cyclin-dependent kinase inhibitor 1B which is also known as p27 or KIP1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T A 13: 77,267,777 L663Q probably damaging Het
2610008E11Rik C G 10: 79,067,734 R249S probably benign Het
6030469F06Rik A G 12: 31,185,059 N146S noncoding transcript Het
Abcb5 G A 12: 118,874,732 P1032S probably benign Het
Acvr2a A T 2: 48,899,724 D493V possibly damaging Het
Amacr A G 15: 10,994,918 D272G probably benign Het
Bach1 A C 16: 87,729,579 K643T probably damaging Het
Bmt2 T C 6: 13,628,673 Y337C probably damaging Het
Bsn A G 9: 108,117,379 S566P probably benign Het
Cass4 A C 2: 172,427,174 D392A probably benign Het
Cbx2 A G 11: 119,028,128 E173G probably damaging Het
Ccdc166 G C 15: 75,981,011 A369G probably benign Het
Ccdc77 G A 6: 120,331,909 T315M possibly damaging Het
Ceacam10 C A 7: 24,781,088 H215N unknown Het
Ces1e C T 8: 93,203,319 M445I probably benign Het
Ces2b T G 8: 104,836,480 V350G possibly damaging Het
Chtf18 A G 17: 25,722,191 L611P probably benign Het
Col9a1 C A 1: 24,178,299 P19T unknown Het
Csf1r A T 18: 61,117,678 N487I probably damaging Het
Csl A T 10: 99,758,299 H301Q probably damaging Het
Cyp24a1 G A 2: 170,490,116 T330M probably damaging Het
Ddb2 T C 2: 91,212,300 D405G probably damaging Het
Degs1 A G 1: 182,282,676 F10L probably benign Het
Dhrs2 T A 14: 55,240,471 I220N probably damaging Het
Dlg5 T C 14: 24,148,260 D1535G possibly damaging Het
Dpy19l1 A G 9: 24,503,076 S19P probably benign Het
Eif3l A C 15: 79,079,020 E134A possibly damaging Het
Epb41 C A 4: 131,937,461 V90L Het
Flad1 A T 3: 89,408,802 V151D probably damaging Het
Gja10 A T 4: 32,601,568 I272N probably benign Het
Glmp T A 3: 88,326,273 D178E probably benign Het
Gm16494 G A 17: 47,016,824 P45S probably damaging Het
Gm4553 T C 7: 142,165,721 D6G unknown Het
Grid2 G A 6: 63,256,945 probably null Het
Icmt A G 4: 152,303,025 M226V probably benign Het
Igkv5-39 T C 6: 69,900,623 S50G probably benign Het
Ints5 T C 19: 8,895,120 S148P probably damaging Het
Itga2b A C 11: 102,461,159 V504G possibly damaging Het
Krt20 T A 11: 99,432,237 Y253F probably damaging Het
Man2a2 T A 7: 80,368,908 I68L probably damaging Het
Mpi G A 9: 57,548,671 T176I probably benign Het
Msh6 C T 17: 87,986,912 R1032C probably damaging Het
Myot C T 18: 44,342,349 T179I probably damaging Het
Neb A G 2: 52,226,589 S946P Het
Notch3 G A 17: 32,122,739 A2013V probably damaging Het
Nr1d1 T C 11: 98,771,307 Y167C probably damaging Het
Olfr1090 A C 2: 86,754,549 L63R probably damaging Het
Olfr652 T A 7: 104,564,386 F55Y probably benign Het
Olfr668 T C 7: 104,925,621 I48V probably benign Het
Olfr851 A G 9: 19,497,081 E111G probably damaging Het
P4ha3 G A 7: 100,317,102 V485M probably damaging Het
Pbk T A 14: 65,816,736 C243* probably null Het
Pde4b T A 4: 102,602,786 L388H possibly damaging Het
Pecam1 T C 11: 106,688,919 D439G probably benign Het
Pknox2 A T 9: 36,911,163 M230K probably benign Het
Plekhh2 A G 17: 84,600,685 I1185V probably damaging Het
Polr3g A G 13: 81,694,563 V111A unknown Het
Prkcg G C 7: 3,329,064 E562D probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rps16 T A 7: 28,352,583 S129T probably benign Het
Scg2 A T 1: 79,435,505 N460K probably benign Het
Sct T C 7: 141,278,894 S42G probably damaging Het
Spef2 A T 15: 9,727,543 N151K probably benign Het
Syce1l C A 8: 113,654,089 D144E possibly damaging Het
Syt17 T C 7: 118,436,846 Y99C probably damaging Het
Tgfbr3 T C 5: 107,139,774 N520D probably damaging Het
Thsd7b A G 1: 129,595,456 S76G probably benign Het
Tmem63a G T 1: 180,961,120 V341F probably benign Het
Trim5 A G 7: 104,265,786 S359P probably damaging Het
Tst A T 15: 78,399,820 V269E probably damaging Het
Ubr3 A T 2: 69,954,362 I808F probably null Het
Ugt3a2 T A 15: 9,361,938 Y267N probably benign Het
Zfp36l2 G T 17: 84,187,124 N28K probably damaging Het
Zfp57 A G 17: 37,010,244 D330G probably benign Het
Zgrf1 C A 3: 127,583,995 S963Y probably damaging Het
Zranb2 A G 3: 157,541,775 K197E unknown Het
Other mutations in Rnf123
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Rnf123 APN 9 108067395 critical splice donor site probably null
IGL01358:Rnf123 APN 9 108069182 missense probably damaging 1.00
IGL01464:Rnf123 APN 9 108052302 missense probably damaging 1.00
IGL01637:Rnf123 APN 9 108058238 missense probably damaging 1.00
IGL01669:Rnf123 APN 9 108058356 missense probably damaging 0.98
IGL01905:Rnf123 APN 9 108071370 splice site probably benign
IGL02070:Rnf123 APN 9 108068302 nonsense probably null
IGL02072:Rnf123 APN 9 108068302 nonsense probably null
IGL02073:Rnf123 APN 9 108068302 nonsense probably null
IGL02074:Rnf123 APN 9 108066889 missense probably damaging 1.00
IGL02079:Rnf123 APN 9 108068302 nonsense probably null
IGL02080:Rnf123 APN 9 108068302 nonsense probably null
IGL02231:Rnf123 APN 9 108066399 missense probably benign 0.17
IGL02281:Rnf123 APN 9 108071452 missense probably benign 0.01
IGL02336:Rnf123 APN 9 108061842 missense probably damaging 1.00
IGL02543:Rnf123 APN 9 108066348 missense probably damaging 1.00
IGL02565:Rnf123 APN 9 108052212 critical splice donor site probably null
IGL02571:Rnf123 APN 9 108068302 nonsense probably null
IGL02572:Rnf123 APN 9 108068302 nonsense probably null
IGL02574:Rnf123 APN 9 108068302 nonsense probably null
IGL02586:Rnf123 APN 9 108068302 nonsense probably null
IGL02589:Rnf123 APN 9 108068302 nonsense probably null
IGL02600:Rnf123 APN 9 108068302 nonsense probably null
IGL02601:Rnf123 APN 9 108068302 nonsense probably null
IGL02602:Rnf123 APN 9 108068302 nonsense probably null
IGL02603:Rnf123 APN 9 108068302 nonsense probably null
IGL02609:Rnf123 APN 9 108068302 nonsense probably null
IGL02628:Rnf123 APN 9 108068302 nonsense probably null
IGL02629:Rnf123 APN 9 108068302 nonsense probably null
IGL02629:Rnf123 APN 9 108070789 splice site probably benign
IGL02630:Rnf123 APN 9 108068302 nonsense probably null
IGL02631:Rnf123 APN 9 108068302 nonsense probably null
IGL02632:Rnf123 APN 9 108068302 nonsense probably null
IGL02650:Rnf123 APN 9 108069748 missense probably benign 0.29
IGL02690:Rnf123 APN 9 108068302 nonsense probably null
IGL02691:Rnf123 APN 9 108068302 nonsense probably null
IGL02692:Rnf123 APN 9 108068302 nonsense probably null
IGL02693:Rnf123 APN 9 108068302 nonsense probably null
IGL02713:Rnf123 APN 9 108068302 nonsense probably null
IGL02736:Rnf123 APN 9 108068302 nonsense probably null
IGL02929:Rnf123 APN 9 108069076 missense probably benign
R1175:Rnf123 UTSW 9 108077373 missense probably benign
R1465:Rnf123 UTSW 9 108071466 splice site probably benign
R1502:Rnf123 UTSW 9 108068510 splice site probably null
R1682:Rnf123 UTSW 9 108077398 missense probably benign 0.16
R1817:Rnf123 UTSW 9 108062926 missense probably benign 0.41
R1855:Rnf123 UTSW 9 108061791 missense probably damaging 1.00
R2394:Rnf123 UTSW 9 108063536 missense probably benign 0.00
R2483:Rnf123 UTSW 9 108063521 missense probably benign 0.16
R3896:Rnf123 UTSW 9 108069103 splice site probably benign
R3940:Rnf123 UTSW 9 108064035 splice site probably benign
R4206:Rnf123 UTSW 9 108063963 missense probably benign 0.01
R4641:Rnf123 UTSW 9 108058587 missense probably damaging 1.00
R4714:Rnf123 UTSW 9 108052439 splice site probably null
R4767:Rnf123 UTSW 9 108052089 missense probably damaging 1.00
R4849:Rnf123 UTSW 9 108056091 missense probably damaging 1.00
R4899:Rnf123 UTSW 9 108063680 missense probably damaging 1.00
R5274:Rnf123 UTSW 9 108064003 frame shift probably null
R5275:Rnf123 UTSW 9 108064003 frame shift probably null
R5276:Rnf123 UTSW 9 108064003 frame shift probably null
R5294:Rnf123 UTSW 9 108064003 frame shift probably null
R5295:Rnf123 UTSW 9 108064003 frame shift probably null
R5394:Rnf123 UTSW 9 108070731 missense probably damaging 1.00
R5717:Rnf123 UTSW 9 108067424 missense probably damaging 1.00
R6186:Rnf123 UTSW 9 108069958 missense possibly damaging 0.55
R6449:Rnf123 UTSW 9 108056053 missense probably benign 0.17
R6502:Rnf123 UTSW 9 108068332 missense possibly damaging 0.46
R6944:Rnf123 UTSW 9 108063623 missense probably benign 0.02
R7003:Rnf123 UTSW 9 108063683 critical splice acceptor site probably null
R7088:Rnf123 UTSW 9 108058536 missense probably null 1.00
R7092:Rnf123 UTSW 9 108068600 missense probably benign 0.07
R7100:Rnf123 UTSW 9 108056639 missense probably damaging 1.00
R7257:Rnf123 UTSW 9 108069029 missense probably damaging 1.00
R7453:Rnf123 UTSW 9 108070408 splice site probably null
R7468:Rnf123 UTSW 9 108069009 missense probably benign 0.00
R7517:Rnf123 UTSW 9 108070274 nonsense probably null
R7577:Rnf123 UTSW 9 108070619 missense probably damaging 1.00
R8322:Rnf123 UTSW 9 108068507 missense probably benign 0.26
Z1176:Rnf123 UTSW 9 108058395 missense probably damaging 1.00
Z1176:Rnf123 UTSW 9 108062981 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACCTAGTCTGGACCCAGC -3'
(R):5'- CCAGGAGCTTGTGAATATTTAAGAG -3'

Sequencing Primer
(F):5'- GCCTGCAAAGTTCCCAAAATTG -3'
(R):5'- TTAAGGTCAGCCAGGTCTGCATAC -3'
Posted On2020-07-28