Incidental Mutation 'R0697:Aig1'
ID63897
Institutional Source Beutler Lab
Gene Symbol Aig1
Ensembl Gene ENSMUSG00000019806
Gene Nameandrogen-induced 1
Synonyms1500031O19Rik, CGI-103
MMRRC Submission 038881-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0697 (G1)
Quality Score152
Status Not validated
Chromosome10
Chromosomal Location13647054-13868980 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13829325 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 72 (N72S)
Ref Sequence ENSEMBL: ENSMUSP00000125366 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019942] [ENSMUST00000105534] [ENSMUST00000162610]
Predicted Effect probably benign
Transcript: ENSMUST00000019942
AA Change: N72S

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000019942
Gene: ENSMUSG00000019806
AA Change: N72S

DomainStartEndE-ValueType
Pfam:Far-17a_AIG1 12 219 5.6e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105534
AA Change: N72S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000101174
Gene: ENSMUSG00000019806
AA Change: N72S

DomainStartEndE-ValueType
Pfam:Far-17a_AIG1 12 178 3.4e-59 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161729
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162174
Predicted Effect probably benign
Transcript: ENSMUST00000162610
AA Change: N72S

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000125366
Gene: ENSMUSG00000019806
AA Change: N72S

DomainStartEndE-ValueType
Pfam:Far-17a_AIG1 12 219 5.4e-74 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162869
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 21 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf C A 19: 31,911,167 A99E probably damaging Het
Atad2 T C 15: 58,105,543 I857M possibly damaging Het
Ceacam15 A C 7: 16,673,520 L24* probably null Het
Cpsf2 A G 12: 101,983,184 H53R probably benign Het
Crh C A 3: 19,694,077 G134C probably damaging Het
Cyp2g1 A T 7: 26,814,727 K253* probably null Het
Dna2 T C 10: 62,949,341 V79A probably benign Het
Dsc2 A G 18: 20,041,452 V549A probably damaging Het
Etl4 G T 2: 20,743,861 V135F probably damaging Het
Frk A G 10: 34,607,837 H398R probably benign Het
Gfra1 A C 19: 58,270,123 S271A probably benign Het
Htr1b T C 9: 81,631,463 I364V possibly damaging Het
Kcnh5 A T 12: 74,976,531 C588S possibly damaging Het
Kif13a G A 13: 46,848,337 T70I probably benign Het
Klra6 T C 6: 130,016,724 I195V probably benign Het
Nras T C 3: 103,060,300 Y71H possibly damaging Het
Sirt5 T C 13: 43,385,576 F274L probably damaging Het
Synj1 T C 16: 90,960,615 T882A probably benign Het
Vmn1r84 A T 7: 12,362,763 M1K probably null Het
Zfhx4 A T 3: 5,401,733 E2317V probably damaging Het
Zfp345 A T 2: 150,472,909 I236K probably benign Het
Other mutations in Aig1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02343:Aig1 APN 10 13868674 missense probably damaging 0.99
IGL02715:Aig1 APN 10 13868616 critical splice donor site probably null
R1699:Aig1 UTSW 10 13868622 missense possibly damaging 0.85
R1761:Aig1 UTSW 10 13690584 missense probably damaging 1.00
R3934:Aig1 UTSW 10 13801912 missense probably damaging 1.00
R4397:Aig1 UTSW 10 13652982 missense probably benign 0.00
R4736:Aig1 UTSW 10 13801930 missense probably damaging 0.97
R4767:Aig1 UTSW 10 13801858 missense probably damaging 1.00
R5081:Aig1 UTSW 10 13801900 missense probably benign 0.01
R5907:Aig1 UTSW 10 13801784 intron probably benign
R7944:Aig1 UTSW 10 13868673 missense probably damaging 1.00
X0018:Aig1 UTSW 10 13690524 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AACCTTGGGTGAGCCATGAGGTAG -3'
(R):5'- tagcaacagcccaaaccGACGTTTT -3'

Sequencing Primer
(F):5'- GAAAGAGCCCTCATTaaaaaacaaac -3'
(R):5'- ccaaaccGACGTTTTGGGTC -3'
Posted On2013-07-30