Incidental Mutation 'R8296:Ugt3a2'
ID638970
Institutional Source Beutler Lab
Gene Symbol Ugt3a2
Ensembl Gene ENSMUSG00000049152
Gene NameUDP glycosyltransferases 3 family, polypeptide A2
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R8296 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location9335550-9370955 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 9361938 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 267 (Y267N)
Ref Sequence ENSEMBL: ENSMUSP00000072236 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072403]
Predicted Effect probably benign
Transcript: ENSMUST00000072403
AA Change: Y267N

PolyPhen 2 Score 0.178 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000072236
Gene: ENSMUSG00000049152
AA Change: Y267N

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:UDPGT 23 521 1.1e-99 PFAM
Pfam:Glyco_tran_28_C 307 450 1.5e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T A 13: 77,267,777 L663Q probably damaging Het
2610008E11Rik C G 10: 79,067,734 R249S probably benign Het
6030469F06Rik A G 12: 31,185,059 N146S noncoding transcript Het
Abcb5 G A 12: 118,874,732 P1032S probably benign Het
Acvr2a A T 2: 48,899,724 D493V possibly damaging Het
Amacr A G 15: 10,994,918 D272G probably benign Het
Bach1 A C 16: 87,729,579 K643T probably damaging Het
Bmt2 T C 6: 13,628,673 Y337C probably damaging Het
Bsn A G 9: 108,117,379 S566P probably benign Het
Cass4 A C 2: 172,427,174 D392A probably benign Het
Cbx2 A G 11: 119,028,128 E173G probably damaging Het
Ccdc166 G C 15: 75,981,011 A369G probably benign Het
Ccdc77 G A 6: 120,331,909 T315M possibly damaging Het
Ceacam10 C A 7: 24,781,088 H215N unknown Het
Ces1e C T 8: 93,203,319 M445I probably benign Het
Ces2b T G 8: 104,836,480 V350G possibly damaging Het
Chtf18 A G 17: 25,722,191 L611P probably benign Het
Col9a1 C A 1: 24,178,299 P19T unknown Het
Csf1r A T 18: 61,117,678 N487I probably damaging Het
Csl A T 10: 99,758,299 H301Q probably damaging Het
Cyp24a1 G A 2: 170,490,116 T330M probably damaging Het
Ddb2 T C 2: 91,212,300 D405G probably damaging Het
Degs1 A G 1: 182,282,676 F10L probably benign Het
Dhrs2 T A 14: 55,240,471 I220N probably damaging Het
Dlg5 T C 14: 24,148,260 D1535G possibly damaging Het
Dpy19l1 A G 9: 24,503,076 S19P probably benign Het
Eif3l A C 15: 79,079,020 E134A possibly damaging Het
Epb41 C A 4: 131,937,461 V90L Het
Flad1 A T 3: 89,408,802 V151D probably damaging Het
Gja10 A T 4: 32,601,568 I272N probably benign Het
Glmp T A 3: 88,326,273 D178E probably benign Het
Gm16494 G A 17: 47,016,824 P45S probably damaging Het
Gm4553 T C 7: 142,165,721 D6G unknown Het
Grid2 G A 6: 63,256,945 probably null Het
Icmt A G 4: 152,303,025 M226V probably benign Het
Igkv5-39 T C 6: 69,900,623 S50G probably benign Het
Ints5 T C 19: 8,895,120 S148P probably damaging Het
Itga2b A C 11: 102,461,159 V504G possibly damaging Het
Krt20 T A 11: 99,432,237 Y253F probably damaging Het
Man2a2 T A 7: 80,368,908 I68L probably damaging Het
Mpi G A 9: 57,548,671 T176I probably benign Het
Msh6 C T 17: 87,986,912 R1032C probably damaging Het
Myot C T 18: 44,342,349 T179I probably damaging Het
Neb A G 2: 52,226,589 S946P Het
Notch3 G A 17: 32,122,739 A2013V probably damaging Het
Nr1d1 T C 11: 98,771,307 Y167C probably damaging Het
Olfr1090 A C 2: 86,754,549 L63R probably damaging Het
Olfr652 T A 7: 104,564,386 F55Y probably benign Het
Olfr668 T C 7: 104,925,621 I48V probably benign Het
Olfr851 A G 9: 19,497,081 E111G probably damaging Het
P4ha3 G A 7: 100,317,102 V485M probably damaging Het
Pbk T A 14: 65,816,736 C243* probably null Het
Pde4b T A 4: 102,602,786 L388H possibly damaging Het
Pecam1 T C 11: 106,688,919 D439G probably benign Het
Pknox2 A T 9: 36,911,163 M230K probably benign Het
Plekhh2 A G 17: 84,600,685 I1185V probably damaging Het
Polr3g A G 13: 81,694,563 V111A unknown Het
Prkcg G C 7: 3,329,064 E562D probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Rnf123 A T 9: 108,062,890 V768D probably damaging Het
Rps16 T A 7: 28,352,583 S129T probably benign Het
Scg2 A T 1: 79,435,505 N460K probably benign Het
Sct T C 7: 141,278,894 S42G probably damaging Het
Spef2 A T 15: 9,727,543 N151K probably benign Het
Syce1l C A 8: 113,654,089 D144E possibly damaging Het
Syt17 T C 7: 118,436,846 Y99C probably damaging Het
Tgfbr3 T C 5: 107,139,774 N520D probably damaging Het
Thsd7b A G 1: 129,595,456 S76G probably benign Het
Tmem63a G T 1: 180,961,120 V341F probably benign Het
Trim5 A G 7: 104,265,786 S359P probably damaging Het
Tst A T 15: 78,399,820 V269E probably damaging Het
Ubr3 A T 2: 69,954,362 I808F probably null Het
Zfp36l2 G T 17: 84,187,124 N28K probably damaging Het
Zfp57 A G 17: 37,010,244 D330G probably benign Het
Zgrf1 C A 3: 127,583,995 S963Y probably damaging Het
Zranb2 A G 3: 157,541,775 K197E unknown Het
Other mutations in Ugt3a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Ugt3a2 APN 15 9367268 missense probably damaging 0.99
IGL01131:Ugt3a2 APN 15 9365162 missense probably damaging 1.00
IGL01627:Ugt3a2 APN 15 9335720 missense probably damaging 1.00
IGL01746:Ugt3a2 APN 15 9361668 missense probably damaging 1.00
IGL01949:Ugt3a2 APN 15 9335729 missense probably damaging 1.00
IGL02213:Ugt3a2 APN 15 9370224 missense probably benign 0.00
IGL02407:Ugt3a2 APN 15 9365230 nonsense probably null
IGL02588:Ugt3a2 APN 15 9361456 missense probably benign
IGL02894:Ugt3a2 APN 15 9367401 missense probably damaging 1.00
IGL02966:Ugt3a2 APN 15 9370068 missense probably damaging 1.00
IGL03385:Ugt3a2 APN 15 9338738 missense probably damaging 0.99
IGL03493:Ugt3a2 APN 15 9361483 missense probably damaging 0.96
R0554:Ugt3a2 UTSW 15 9351120 missense probably benign 0.14
R0833:Ugt3a2 UTSW 15 9370150 missense probably damaging 0.96
R1071:Ugt3a2 UTSW 15 9367368 missense possibly damaging 0.82
R1513:Ugt3a2 UTSW 15 9361524 missense probably benign 0.07
R1844:Ugt3a2 UTSW 15 9351168 missense probably benign 0.07
R1874:Ugt3a2 UTSW 15 9365351 missense probably damaging 1.00
R2305:Ugt3a2 UTSW 15 9351117 missense probably benign
R3052:Ugt3a2 UTSW 15 9365288 missense probably damaging 1.00
R3755:Ugt3a2 UTSW 15 9367412 missense probably benign 0.21
R3945:Ugt3a2 UTSW 15 9370098 missense possibly damaging 0.91
R4135:Ugt3a2 UTSW 15 9338724 missense probably damaging 0.98
R4261:Ugt3a2 UTSW 15 9335793 splice site probably null
R4438:Ugt3a2 UTSW 15 9351197 missense probably benign 0.01
R4570:Ugt3a2 UTSW 15 9338721 missense probably benign 0.12
R4791:Ugt3a2 UTSW 15 9361579 missense probably damaging 1.00
R4957:Ugt3a2 UTSW 15 9365188 missense probably benign 0.27
R5011:Ugt3a2 UTSW 15 9365287 missense probably damaging 1.00
R5035:Ugt3a2 UTSW 15 9361618 missense probably benign 0.01
R5554:Ugt3a2 UTSW 15 9370201 missense probably damaging 1.00
R5573:Ugt3a2 UTSW 15 9361683 missense probably damaging 1.00
R5631:Ugt3a2 UTSW 15 9361885 missense probably damaging 0.98
R5696:Ugt3a2 UTSW 15 9361448 splice site silent
R6265:Ugt3a2 UTSW 15 9361579 missense probably damaging 1.00
R6302:Ugt3a2 UTSW 15 9365311 missense probably damaging 1.00
R6311:Ugt3a2 UTSW 15 9361518 nonsense probably null
R6680:Ugt3a2 UTSW 15 9370068 missense probably damaging 1.00
R8229:Ugt3a2 UTSW 15 9367377 missense probably damaging 0.99
Z1177:Ugt3a2 UTSW 15 9367257 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- ACCAAATGGACTTCTGGGGC -3'
(R):5'- AAAAGTGTAGGCTGCAAATATCTCC -3'

Sequencing Primer
(F):5'- CCGAGTGAAGAACTTTCTGATGTTCC -3'
(R):5'- GTGTAGGCTGCAAATATCTCCCTTAC -3'
Posted On2020-07-28