Incidental Mutation 'R8297:Xrcc5'
ID638988
Institutional Source Beutler Lab
Gene Symbol Xrcc5
Ensembl Gene ENSMUSG00000026187
Gene NameX-ray repair complementing defective repair in Chinese hamster cells 5
SynonymsKu86, Ku80
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8297 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location72307421-72394952 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 72325085 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 232 (R232Q)
Ref Sequence ENSEMBL: ENSMUSP00000027379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027379]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027379
AA Change: R232Q

PolyPhen 2 Score 0.469 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000027379
Gene: ENSMUSG00000026187
AA Change: R232Q

DomainStartEndE-ValueType
VWA 7 245 8.07e-2 SMART
Ku78 302 441 8.9e-52 SMART
Pfam:Ku_C 476 570 6.9e-23 PFAM
Pfam:Ku_PK_bind 594 707 9.3e-31 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the 80-kilodalton subunit of the Ku heterodimer protein which is also known as ATP-dependant DNA helicase II or DNA repair protein XRCC5. Ku is the DNA-binding component of the DNA-dependent protein kinase, and it functions together with the DNA ligase IV-XRCC4 complex in the repair of DNA double-strand break by non-homologous end joining and the completion of V(D)J recombination events. This gene functionally complements Chinese hamster xrs-6, a mutant defective in DNA double-strand break repair and in ability to undergo V(D)J recombination. A rare microsatellite polymorphism in this gene is associated with cancer in patients of varying radiosensitivity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants are defective in DNA double-strand break repair and show impaired growth and severe combined immunodeficiency due to defective assembly of TCRs and immunoglobulins. Mutants die early with osteopenia, atrophic skin and hepatic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik T C 10: 21,621,679 L73P probably damaging Het
4933412E24Rik T G 15: 60,015,675 R305S probably damaging Het
Adamts19 T A 18: 58,837,848 V168E probably damaging Het
Ankrd34b T A 13: 92,439,589 L443Q probably damaging Het
Ano3 A G 2: 110,661,271 Y887H probably damaging Het
Arhgef2 A T 3: 88,639,432 H553L probably benign Het
Atxn1 G T 13: 45,567,029 N463K probably benign Het
Birc6 A G 17: 74,625,104 probably null Het
C4bp A G 1: 130,636,745 S401P probably damaging Het
Cd5 T A 19: 10,720,245 R457W probably damaging Het
Chek2 T G 5: 110,848,436 Y127D probably damaging Het
Clec4a1 G A 6: 122,922,001 V10M probably damaging Het
Cltc A G 11: 86,712,631 Y790H probably damaging Het
Cops2 T C 2: 125,859,108 probably benign Het
Cyb5d2 A G 11: 72,789,103 F122S probably damaging Het
Daam1 T A 12: 71,951,915 L548H unknown Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Dsg1a A C 18: 20,332,033 N427T probably benign Het
Ear14 A T 14: 51,204,107 D140V probably damaging Het
Epha4 A C 1: 77,506,910 F154C probably damaging Het
Ets2 G A 16: 95,706,454 V12M probably damaging Het
Fbxo40 G A 16: 36,969,308 T480I probably damaging Het
Fdps A T 3: 89,093,741 Y322N probably damaging Het
Gca T C 2: 62,686,356 M132T probably benign Het
Ifi203 T G 1: 173,937,930 K26T probably damaging Het
Itga10 A G 3: 96,654,800 R668G probably damaging Het
Itgal T C 7: 127,330,466 I1185T unknown Het
Kcnj13 A T 1: 87,386,467 N344K probably damaging Het
Kdm5a A T 6: 120,381,555 L186F probably benign Het
Klhl8 T C 5: 103,863,088 N624D probably benign Het
Klrb1 G T 6: 128,712,259 T83K possibly damaging Het
Krt77 TGCCGCCGCCGCCGCCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCGCCGC 15: 101,859,972 probably benign Het
Ltb G T 17: 35,194,679 R53L probably benign Het
Mterf3 A G 13: 66,907,158 V69A Het
Mvb12a A G 8: 71,545,244 K101E probably damaging Het
Nbeal2 T A 9: 110,635,341 Q1110L possibly damaging Het
Neb T A 2: 52,308,763 T389S possibly damaging Het
Nol4 A G 18: 23,040,012 F11L probably damaging Het
Olfr132 A G 17: 38,130,593 S200P probably damaging Het
Olfr441 A G 6: 43,116,506 I255V probably benign Het
Olfr675 C T 7: 105,024,678 G97R probably benign Het
Olfr9 T C 10: 128,990,839 L309P possibly damaging Het
Pde2a T A 7: 101,504,673 Y487N possibly damaging Het
Pde4a C T 9: 21,166,108 P61S possibly damaging Het
Pramef25 T A 4: 143,949,120 T379S probably benign Het
Prr5l A G 2: 101,741,285 probably null Het
Ptpn6 G A 6: 124,728,651 T179I possibly damaging Het
Ralyl T C 3: 14,039,776 S34P probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Robo2 A T 16: 74,015,926 C293* probably null Het
Rtn4 T G 11: 29,705,536 D169E probably damaging Het
Slc22a22 A T 15: 57,259,110 V157E probably damaging Het
Sytl2 A G 7: 90,385,075 T498A probably benign Het
Tgm6 G A 2: 130,137,438 V163I probably benign Het
Tnpo3 A T 6: 29,582,303 C187S possibly damaging Het
Ttn A G 2: 76,786,141 probably null Het
Vangl2 C A 1: 172,009,946 V99F possibly damaging Het
Vmn1r167 C T 7: 23,504,790 C267Y probably damaging Het
Vsig10l T C 7: 43,464,107 V161A possibly damaging Het
Xrcc6 C G 15: 82,029,262 F365L probably damaging Het
Zcchc11 G A 4: 108,479,708 A210T possibly damaging Het
Zdhhc13 A G 7: 48,815,509 Y389C probably damaging Het
Other mutations in Xrcc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01396:Xrcc5 APN 1 72354245 missense probably benign 0.01
IGL01599:Xrcc5 APN 1 72346349 missense possibly damaging 0.72
IGL01714:Xrcc5 APN 1 72329984 missense probably damaging 0.98
IGL02740:Xrcc5 APN 1 72340081 critical splice donor site probably null
IGL02884:Xrcc5 APN 1 72346237 missense possibly damaging 0.95
durio UTSW 1 72339029 missense probably damaging 1.00
xenophobe UTSW 1 72312436 missense probably damaging 1.00
zibethinus UTSW 1 72310458 missense probably damaging 1.00
PIT4362001:Xrcc5 UTSW 1 72393929 missense probably benign
R0309:Xrcc5 UTSW 1 72307576 unclassified probably benign
R0485:Xrcc5 UTSW 1 72338945 splice site probably benign
R1004:Xrcc5 UTSW 1 72383778 splice site probably benign
R1421:Xrcc5 UTSW 1 72310477 missense probably benign 0.00
R1530:Xrcc5 UTSW 1 72329944 missense probably damaging 0.98
R1694:Xrcc5 UTSW 1 72319096 missense possibly damaging 0.88
R1750:Xrcc5 UTSW 1 72325087 nonsense probably null
R2037:Xrcc5 UTSW 1 72346370 missense probably benign 0.01
R2296:Xrcc5 UTSW 1 72346326 missense probably benign 0.00
R4299:Xrcc5 UTSW 1 72394720 makesense probably null
R4388:Xrcc5 UTSW 1 72330030 missense possibly damaging 0.46
R4527:Xrcc5 UTSW 1 72312500 missense probably damaging 1.00
R4857:Xrcc5 UTSW 1 72326265 missense possibly damaging 0.92
R5073:Xrcc5 UTSW 1 72339029 missense probably damaging 1.00
R5233:Xrcc5 UTSW 1 72340050 missense probably damaging 1.00
R5521:Xrcc5 UTSW 1 72346271 missense probably damaging 1.00
R5996:Xrcc5 UTSW 1 72310458 missense probably damaging 1.00
R6583:Xrcc5 UTSW 1 72312593 critical splice donor site probably null
R6638:Xrcc5 UTSW 1 72383362 missense possibly damaging 0.94
R6935:Xrcc5 UTSW 1 72343030 missense possibly damaging 0.82
R7046:Xrcc5 UTSW 1 72394716 missense probably benign 0.00
R7446:Xrcc5 UTSW 1 72393973 splice site probably null
R7473:Xrcc5 UTSW 1 72312589 missense probably damaging 1.00
R7875:Xrcc5 UTSW 1 72329931 missense probably damaging 1.00
R7889:Xrcc5 UTSW 1 72356826 missense probably benign 0.45
R8088:Xrcc5 UTSW 1 72312436 missense probably damaging 1.00
R8179:Xrcc5 UTSW 1 72356857 missense probably damaging 0.99
R8309:Xrcc5 UTSW 1 72319127 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- ACAGTGACTGGAGTTCTCCCTC -3'
(R):5'- GCTCGCACATGAATTGTCAGC -3'

Sequencing Primer
(F):5'- AAGCCAGCTCACCTGTCTCTG -3'
(R):5'- GCACATGAATTGTCAGCTTCTTAC -3'
Posted On2020-07-28