Incidental Mutation 'R8297:Kcnj13'
ID638990
Institutional Source Beutler Lab
Gene Symbol Kcnj13
Ensembl Gene ENSMUSG00000079436
Gene Namepotassium inwardly-rectifying channel, subfamily J, member 13
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8297 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location87386363-87394729 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87386467 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 344 (N344K)
Ref Sequence ENSEMBL: ENSMUSP00000108838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027475] [ENSMUST00000113212] [ENSMUST00000164992] [ENSMUST00000172794] [ENSMUST00000172964] [ENSMUST00000173173] [ENSMUST00000174179] [ENSMUST00000174334] [ENSMUST00000174501]
Predicted Effect probably benign
Transcript: ENSMUST00000027475
SMART Domains Protein: ENSMUSP00000027475
Gene: ENSMUSG00000048000

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 99 132 N/A INTRINSIC
low complexity region 143 155 N/A INTRINSIC
low complexity region 247 285 N/A INTRINSIC
low complexity region 330 341 N/A INTRINSIC
internal_repeat_1 344 384 2.48e-5 PROSPERO
internal_repeat_1 404 440 2.48e-5 PROSPERO
GYF 535 590 2.83e-26 SMART
low complexity region 620 667 N/A INTRINSIC
coiled coil region 723 1037 N/A INTRINSIC
low complexity region 1096 1110 N/A INTRINSIC
low complexity region 1119 1130 N/A INTRINSIC
coiled coil region 1194 1223 N/A INTRINSIC
low complexity region 1236 1246 N/A INTRINSIC
low complexity region 1254 1260 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113212
AA Change: N344K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108838
Gene: ENSMUSG00000079436
AA Change: N344K

DomainStartEndE-ValueType
Pfam:IRK 21 345 3.5e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164992
SMART Domains Protein: ENSMUSP00000129046
Gene: ENSMUSG00000048000

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 99 129 N/A INTRINSIC
low complexity region 190 228 N/A INTRINSIC
low complexity region 273 284 N/A INTRINSIC
GYF 478 533 2.83e-26 SMART
low complexity region 563 610 N/A INTRINSIC
coiled coil region 666 721 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172794
SMART Domains Protein: ENSMUSP00000134077
Gene: ENSMUSG00000048000

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 99 132 N/A INTRINSIC
low complexity region 143 155 N/A INTRINSIC
low complexity region 241 279 N/A INTRINSIC
low complexity region 324 335 N/A INTRINSIC
internal_repeat_1 338 378 2.29e-5 PROSPERO
internal_repeat_1 398 434 2.29e-5 PROSPERO
GYF 529 584 2.83e-26 SMART
low complexity region 614 661 N/A INTRINSIC
coiled coil region 717 1031 N/A INTRINSIC
low complexity region 1090 1104 N/A INTRINSIC
low complexity region 1113 1124 N/A INTRINSIC
coiled coil region 1188 1217 N/A INTRINSIC
low complexity region 1230 1240 N/A INTRINSIC
low complexity region 1248 1254 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172964
SMART Domains Protein: ENSMUSP00000133392
Gene: ENSMUSG00000048000

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 99 132 N/A INTRINSIC
low complexity region 143 155 N/A INTRINSIC
low complexity region 247 285 N/A INTRINSIC
low complexity region 330 341 N/A INTRINSIC
internal_repeat_1 344 384 3.03e-5 PROSPERO
internal_repeat_1 404 440 3.03e-5 PROSPERO
GYF 535 590 2.83e-26 SMART
low complexity region 620 667 N/A INTRINSIC
SCOP:d1eq1a_ 724 859 1e-2 SMART
low complexity region 953 972 N/A INTRINSIC
low complexity region 1008 1031 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173173
SMART Domains Protein: ENSMUSP00000134193
Gene: ENSMUSG00000048000

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 99 132 N/A INTRINSIC
low complexity region 143 155 N/A INTRINSIC
low complexity region 241 279 N/A INTRINSIC
low complexity region 324 335 N/A INTRINSIC
GYF 528 583 2.83e-26 SMART
low complexity region 613 660 N/A INTRINSIC
SCOP:d1eq1a_ 717 852 1e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174179
SMART Domains Protein: ENSMUSP00000133524
Gene: ENSMUSG00000079436

DomainStartEndE-ValueType
Pfam:IRK 21 80 1.7e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174334
SMART Domains Protein: ENSMUSP00000133666
Gene: ENSMUSG00000048000

DomainStartEndE-ValueType
low complexity region 77 84 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174501
SMART Domains Protein: ENSMUSP00000133327
Gene: ENSMUSG00000048000

DomainStartEndE-ValueType
low complexity region 66 83 N/A INTRINSIC
low complexity region 99 132 N/A INTRINSIC
low complexity region 143 155 N/A INTRINSIC
low complexity region 247 285 N/A INTRINSIC
low complexity region 330 341 N/A INTRINSIC
internal_repeat_1 344 384 2.48e-5 PROSPERO
internal_repeat_1 404 440 2.48e-5 PROSPERO
GYF 535 590 2.83e-26 SMART
low complexity region 620 667 N/A INTRINSIC
coiled coil region 723 1037 N/A INTRINSIC
low complexity region 1096 1110 N/A INTRINSIC
low complexity region 1119 1130 N/A INTRINSIC
coiled coil region 1194 1223 N/A INTRINSIC
low complexity region 1236 1246 N/A INTRINSIC
low complexity region 1254 1260 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the inwardly rectifying potassium channel family of proteins. Members of this family form ion channel pores that allow potassium ions to pass into a cell. The encoded protein belongs to a subfamily of low signal channel conductance proteins that have a low dependence on potassium concentration. Mutations in this gene are associated with snowflake vitreoretinal degeneration. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygous mutant null mice die shortly after birth, exhibit cleft palate and pulmonary abnormalities in embryonic lungs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik T C 10: 21,621,679 L73P probably damaging Het
4933412E24Rik T G 15: 60,015,675 R305S probably damaging Het
Adamts19 T A 18: 58,837,848 V168E probably damaging Het
Ankrd34b T A 13: 92,439,589 L443Q probably damaging Het
Ano3 A G 2: 110,661,271 Y887H probably damaging Het
Arhgef2 A T 3: 88,639,432 H553L probably benign Het
Atxn1 G T 13: 45,567,029 N463K probably benign Het
Birc6 A G 17: 74,625,104 probably null Het
C4bp A G 1: 130,636,745 S401P probably damaging Het
Cd5 T A 19: 10,720,245 R457W probably damaging Het
Chek2 T G 5: 110,848,436 Y127D probably damaging Het
Clec4a1 G A 6: 122,922,001 V10M probably damaging Het
Cltc A G 11: 86,712,631 Y790H probably damaging Het
Cops2 T C 2: 125,859,108 probably benign Het
Cyb5d2 A G 11: 72,789,103 F122S probably damaging Het
Daam1 T A 12: 71,951,915 L548H unknown Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Dsg1a A C 18: 20,332,033 N427T probably benign Het
Ear14 A T 14: 51,204,107 D140V probably damaging Het
Epha4 A C 1: 77,506,910 F154C probably damaging Het
Ets2 G A 16: 95,706,454 V12M probably damaging Het
Fbxo40 G A 16: 36,969,308 T480I probably damaging Het
Fdps A T 3: 89,093,741 Y322N probably damaging Het
Gca T C 2: 62,686,356 M132T probably benign Het
Ifi203 T G 1: 173,937,930 K26T probably damaging Het
Itga10 A G 3: 96,654,800 R668G probably damaging Het
Itgal T C 7: 127,330,466 I1185T unknown Het
Kdm5a A T 6: 120,381,555 L186F probably benign Het
Klhl8 T C 5: 103,863,088 N624D probably benign Het
Klrb1 G T 6: 128,712,259 T83K possibly damaging Het
Krt77 TGCCGCCGCCGCCGCCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCGCCGC 15: 101,859,972 probably benign Het
Ltb G T 17: 35,194,679 R53L probably benign Het
Mterf3 A G 13: 66,907,158 V69A Het
Mvb12a A G 8: 71,545,244 K101E probably damaging Het
Nbeal2 T A 9: 110,635,341 Q1110L possibly damaging Het
Neb T A 2: 52,308,763 T389S possibly damaging Het
Nol4 A G 18: 23,040,012 F11L probably damaging Het
Olfr132 A G 17: 38,130,593 S200P probably damaging Het
Olfr441 A G 6: 43,116,506 I255V probably benign Het
Olfr675 C T 7: 105,024,678 G97R probably benign Het
Olfr9 T C 10: 128,990,839 L309P possibly damaging Het
Pde2a T A 7: 101,504,673 Y487N possibly damaging Het
Pde4a C T 9: 21,166,108 P61S possibly damaging Het
Pramef25 T A 4: 143,949,120 T379S probably benign Het
Prr5l A G 2: 101,741,285 probably null Het
Ptpn6 G A 6: 124,728,651 T179I possibly damaging Het
Ralyl T C 3: 14,039,776 S34P probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Robo2 A T 16: 74,015,926 C293* probably null Het
Rtn4 T G 11: 29,705,536 D169E probably damaging Het
Slc22a22 A T 15: 57,259,110 V157E probably damaging Het
Sytl2 A G 7: 90,385,075 T498A probably benign Het
Tgm6 G A 2: 130,137,438 V163I probably benign Het
Tnpo3 A T 6: 29,582,303 C187S possibly damaging Het
Ttn A G 2: 76,786,141 probably null Het
Vangl2 C A 1: 172,009,946 V99F possibly damaging Het
Vmn1r167 C T 7: 23,504,790 C267Y probably damaging Het
Vsig10l T C 7: 43,464,107 V161A possibly damaging Het
Xrcc5 G A 1: 72,325,085 R232Q possibly damaging Het
Xrcc6 C G 15: 82,029,262 F365L probably damaging Het
Zcchc11 G A 4: 108,479,708 A210T possibly damaging Het
Zdhhc13 A G 7: 48,815,509 Y389C probably damaging Het
Other mutations in Kcnj13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01025:Kcnj13 APN 1 87386978 missense probably benign 0.02
IGL01108:Kcnj13 APN 1 87386937 missense probably benign
IGL01420:Kcnj13 APN 1 87389044 missense probably damaging 1.00
IGL02747:Kcnj13 APN 1 87389365 missense probably benign 0.00
IGL02937:Kcnj13 APN 1 87386453 missense probably damaging 1.00
R0472:Kcnj13 UTSW 1 87386846 missense probably benign 0.22
R0486:Kcnj13 UTSW 1 87387030 missense probably damaging 1.00
R1494:Kcnj13 UTSW 1 87389217 missense probably damaging 1.00
R2131:Kcnj13 UTSW 1 87386534 missense probably benign 0.03
R2392:Kcnj13 UTSW 1 87386900 missense possibly damaging 0.83
R3418:Kcnj13 UTSW 1 87386919 missense probably benign 0.08
R3419:Kcnj13 UTSW 1 87386919 missense probably benign 0.08
R5773:Kcnj13 UTSW 1 87386667 missense probably damaging 0.99
R6215:Kcnj13 UTSW 1 87386534 missense probably benign 0.03
R6284:Kcnj13 UTSW 1 87386886 missense probably damaging 1.00
R6773:Kcnj13 UTSW 1 87386760 missense possibly damaging 0.82
R6830:Kcnj13 UTSW 1 87387023 missense probably damaging 1.00
R7365:Kcnj13 UTSW 1 87389017 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGGCATAGACATCATTACTATG -3'
(R):5'- TCTCAGCAATGCAAGAAGGC -3'

Sequencing Primer
(F):5'- TGATATAATCAGCACTGAGAACAAGG -3'
(R):5'- AGGCACTGGGGAAATCTGCC -3'
Posted On2020-07-28