Incidental Mutation 'R8297:Cops2'
ID638999
Institutional Source Beutler Lab
Gene Symbol Cops2
Ensembl Gene ENSMUSG00000027206
Gene NameCOP9 signalosome subunit 2
SynonymsSgn2, alien-like, alien homologue, Csn2, Trip15
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8297 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location125830304-125859139 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 125859108 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119902 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028635] [ENSMUST00000028636] [ENSMUST00000110462] [ENSMUST00000110463] [ENSMUST00000125084]
Predicted Effect probably benign
Transcript: ENSMUST00000028635
SMART Domains Protein: ENSMUSP00000028635
Gene: ENSMUSG00000027206

DomainStartEndE-ValueType
low complexity region 1 27 N/A INTRINSIC
PAM 169 343 1.08e-64 SMART
PINT 345 427 4.24e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000028636
SMART Domains Protein: ENSMUSP00000028636
Gene: ENSMUSG00000027207

DomainStartEndE-ValueType
Pfam:GalKase_gal_bdg 13 62 3.8e-26 PFAM
Pfam:GHMP_kinases_N 120 187 1e-15 PFAM
Pfam:GHMP_kinases_C 333 419 6.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110462
SMART Domains Protein: ENSMUSP00000106089
Gene: ENSMUSG00000027206

DomainStartEndE-ValueType
low complexity region 1 27 N/A INTRINSIC
PAM 140 302 1.59e-30 SMART
PINT 304 386 4.24e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110463
SMART Domains Protein: ENSMUSP00000106090
Gene: ENSMUSG00000027206

DomainStartEndE-ValueType
low complexity region 1 27 N/A INTRINSIC
PAM 176 350 1.08e-64 SMART
PINT 352 434 4.24e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125084
SMART Domains Protein: ENSMUSP00000119902
Gene: ENSMUSG00000027207

DomainStartEndE-ValueType
Pfam:GalKase_gal_bdg 1 50 7.7e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos very soon after implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik T C 10: 21,621,679 L73P probably damaging Het
4933412E24Rik T G 15: 60,015,675 R305S probably damaging Het
Adamts19 T A 18: 58,837,848 V168E probably damaging Het
Ankrd34b T A 13: 92,439,589 L443Q probably damaging Het
Ano3 A G 2: 110,661,271 Y887H probably damaging Het
Arhgef2 A T 3: 88,639,432 H553L probably benign Het
Atxn1 G T 13: 45,567,029 N463K probably benign Het
Birc6 A G 17: 74,625,104 probably null Het
C4bp A G 1: 130,636,745 S401P probably damaging Het
Cd5 T A 19: 10,720,245 R457W probably damaging Het
Chek2 T G 5: 110,848,436 Y127D probably damaging Het
Clec4a1 G A 6: 122,922,001 V10M probably damaging Het
Cltc A G 11: 86,712,631 Y790H probably damaging Het
Cyb5d2 A G 11: 72,789,103 F122S probably damaging Het
Daam1 T A 12: 71,951,915 L548H unknown Het
Dcp1a A G 14: 30,522,926 T570A possibly damaging Het
Dsg1a A C 18: 20,332,033 N427T probably benign Het
Ear14 A T 14: 51,204,107 D140V probably damaging Het
Epha4 A C 1: 77,506,910 F154C probably damaging Het
Ets2 G A 16: 95,706,454 V12M probably damaging Het
Fbxo40 G A 16: 36,969,308 T480I probably damaging Het
Fdps A T 3: 89,093,741 Y322N probably damaging Het
Gca T C 2: 62,686,356 M132T probably benign Het
Ifi203 T G 1: 173,937,930 K26T probably damaging Het
Itga10 A G 3: 96,654,800 R668G probably damaging Het
Itgal T C 7: 127,330,466 I1185T unknown Het
Kcnj13 A T 1: 87,386,467 N344K probably damaging Het
Kdm5a A T 6: 120,381,555 L186F probably benign Het
Klhl8 T C 5: 103,863,088 N624D probably benign Het
Klrb1 G T 6: 128,712,259 T83K possibly damaging Het
Krt77 TGCCGCCGCCGCCGCCGCCGCCGCCGC TGCCGCCGCCGCCGCCGCCGCCGC 15: 101,859,972 probably benign Het
Ltb G T 17: 35,194,679 R53L probably benign Het
Mterf3 A G 13: 66,907,158 V69A Het
Mvb12a A G 8: 71,545,244 K101E probably damaging Het
Nbeal2 T A 9: 110,635,341 Q1110L possibly damaging Het
Neb T A 2: 52,308,763 T389S possibly damaging Het
Nol4 A G 18: 23,040,012 F11L probably damaging Het
Olfr132 A G 17: 38,130,593 S200P probably damaging Het
Olfr441 A G 6: 43,116,506 I255V probably benign Het
Olfr675 C T 7: 105,024,678 G97R probably benign Het
Olfr9 T C 10: 128,990,839 L309P possibly damaging Het
Pde2a T A 7: 101,504,673 Y487N possibly damaging Het
Pde4a C T 9: 21,166,108 P61S possibly damaging Het
Pramef25 T A 4: 143,949,120 T379S probably benign Het
Prr5l A G 2: 101,741,285 probably null Het
Ptpn6 G A 6: 124,728,651 T179I possibly damaging Het
Ralyl T C 3: 14,039,776 S34P probably benign Het
Rftn1 G T 17: 50,047,380 A318D probably damaging Het
Robo2 A T 16: 74,015,926 C293* probably null Het
Rtn4 T G 11: 29,705,536 D169E probably damaging Het
Slc22a22 A T 15: 57,259,110 V157E probably damaging Het
Sytl2 A G 7: 90,385,075 T498A probably benign Het
Tgm6 G A 2: 130,137,438 V163I probably benign Het
Tnpo3 A T 6: 29,582,303 C187S possibly damaging Het
Ttn A G 2: 76,786,141 probably null Het
Vangl2 C A 1: 172,009,946 V99F possibly damaging Het
Vmn1r167 C T 7: 23,504,790 C267Y probably damaging Het
Vsig10l T C 7: 43,464,107 V161A possibly damaging Het
Xrcc5 G A 1: 72,325,085 R232Q possibly damaging Het
Xrcc6 C G 15: 82,029,262 F365L probably damaging Het
Zcchc11 G A 4: 108,479,708 A210T possibly damaging Het
Zdhhc13 A G 7: 48,815,509 Y389C probably damaging Het
Other mutations in Cops2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02135:Cops2 APN 2 125832243 missense probably benign
IGL02496:Cops2 APN 2 125836243 splice site probably benign
IGL02678:Cops2 APN 2 125844911 missense probably benign 0.30
IGL02930:Cops2 APN 2 125832189 utr 3 prime probably benign
R4634:Cops2 UTSW 2 125840480 missense probably damaging 1.00
R6344:Cops2 UTSW 2 125858979 unclassified probably benign
R8038:Cops2 UTSW 2 125832286 missense probably benign 0.00
R8287:Cops2 UTSW 2 125859117 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGGTCGTAGTCCTCCTCATC -3'
(R):5'- TAGAAACAGACGGTTCCAGAGTCC -3'

Sequencing Primer
(F):5'- TCATCGCACATGAAATCATCCTC -3'
(R):5'- TCACCTAGGACGCTGGATAC -3'
Posted On2020-07-28